ID: 959693685

View in Genome Browser
Species Human (GRCh38)
Location 3:109226663-109226685
Sequence CACCGGGATCAGGTAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959693685_959693693 14 Left 959693685 3:109226663-109226685 CCCAAGCCTACCTGATCCCGGTG No data
Right 959693693 3:109226700-109226722 ATGTACTGTATTTTATCCACTGG No data
959693685_959693694 18 Left 959693685 3:109226663-109226685 CCCAAGCCTACCTGATCCCGGTG No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959693685 Original CRISPR CACCGGGATCAGGTAGGCTT GGG (reversed) Intergenic
No off target data available for this crispr