ID: 959693694

View in Genome Browser
Species Human (GRCh38)
Location 3:109226704-109226726
Sequence ACTGTATTTTATCCACTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959693686_959693694 17 Left 959693686 3:109226664-109226686 CCAAGCCTACCTGATCCCGGTGT No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data
959693688_959693694 8 Left 959693688 3:109226673-109226695 CCTGATCCCGGTGTCATACATTT No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data
959693690_959693694 1 Left 959693690 3:109226680-109226702 CCGGTGTCATACATTTCCCAATG No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data
959693689_959693694 2 Left 959693689 3:109226679-109226701 CCCGGTGTCATACATTTCCCAAT No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data
959693687_959693694 12 Left 959693687 3:109226669-109226691 CCTACCTGATCCCGGTGTCATAC No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data
959693685_959693694 18 Left 959693685 3:109226663-109226685 CCCAAGCCTACCTGATCCCGGTG No data
Right 959693694 3:109226704-109226726 ACTGTATTTTATCCACTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959693694 Original CRISPR ACTGTATTTTATCCACTGGT AGG Intergenic
No off target data available for this crispr