ID: 959700533

View in Genome Browser
Species Human (GRCh38)
Location 3:109294650-109294672
Sequence CTCTGTGCAGAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 480}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959700533_959700537 24 Left 959700533 3:109294650-109294672 CCTTCTTCCCTTTCTGCACAGAG 0: 1
1: 0
2: 4
3: 52
4: 480
Right 959700537 3:109294697-109294719 TAAATTAGCCTTCATTCAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 172
959700533_959700536 -8 Left 959700533 3:109294650-109294672 CCTTCTTCCCTTTCTGCACAGAG 0: 1
1: 0
2: 4
3: 52
4: 480
Right 959700536 3:109294665-109294687 GCACAGAGCTGAGAACTAAGAGG 0: 1
1: 0
2: 3
3: 35
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959700533 Original CRISPR CTCTGTGCAGAAAGGGAAGA AGG (reversed) Intronic
900108886 1:997506-997528 ATCAGTGCAGAAGGGGAAGGAGG - Intergenic
900529175 1:3144360-3144382 CTCTCTGCAGACAGGGCAGCTGG - Intronic
900744091 1:4349236-4349258 TTCTGAGCAGAAAGGGAAAGGGG + Intergenic
900867876 1:5281524-5281546 CTCTGTGCAGCAAATGCAGATGG + Intergenic
900907618 1:5571864-5571886 CTCTCAGCAGAAAGGGAGGCTGG - Intergenic
901286228 1:8081052-8081074 CTCTGAGAAGAAAGGGCTGATGG + Intergenic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
902545437 1:17186696-17186718 CTCCTTGCAGAGAGGGCAGAAGG + Intergenic
905522297 1:38609529-38609551 CTCTCAGCGGAAAGGGAAGCTGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
907797193 1:57729414-57729436 CTCTGCACTGAAAGGGAGGAAGG + Intronic
907858956 1:58332281-58332303 GTCTGTGCAGAGAAGCAAGATGG - Intronic
908063131 1:60372995-60373017 CTCATGGCAGAAAGTGAAGAGGG - Intergenic
908435430 1:64101160-64101182 CTCTGTGCAGAAAGTAAACAGGG + Intronic
908457314 1:64316254-64316276 TTCTGTGTAGAAAGGGCAGAGGG + Intergenic
908715484 1:67065344-67065366 CTGTGTGCAGAAAGGATTGATGG - Intergenic
911476930 1:98385135-98385157 CTCTGGGGAGAAAGGAAAAAAGG - Intergenic
911855697 1:102872337-102872359 GGCAGTGCAGAAAGGGAATATGG - Intergenic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
914219206 1:145663103-145663125 CTCTTTACAGAAAAGAAAGATGG + Intronic
914225853 1:145719019-145719041 CTCCAGGCTGAAAGGGAAGAAGG - Intergenic
914471790 1:147985973-147985995 CTCTTTACAGAAAAGAAAGATGG + Intronic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
916603934 1:166322574-166322596 ATTTGTGCAGAAAGGAAAAATGG + Intergenic
917682997 1:177386784-177386806 CCCTGTACATAAAGGGAACATGG - Intergenic
918262240 1:182806518-182806540 CTTTGGGCTGAAAGGTAAGAGGG + Intronic
919642559 1:200059578-200059600 CAGTGTGCAGACAGGGAACAGGG - Intronic
919976062 1:202613705-202613727 CTGTCTGCAGAAAGGGGAGGAGG - Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920224944 1:204431639-204431661 CTCTGTGCAGATAGTAAAGGGGG + Intronic
921432089 1:215077509-215077531 CTATGTGCAGAACAGGTAGAAGG - Intronic
922167869 1:223130687-223130709 CTCTGTTCAGATAAGGAAGAAGG - Intronic
923857393 1:237859694-237859716 TTCATTGCTGAAAGGGAAGAAGG + Intergenic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
1063336628 10:5221931-5221953 CTATGGACAGAAAGGAAAGACGG + Intergenic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1066210792 10:33235988-33236010 CTCTTTGCAGGAAGGGGAGGAGG - Intronic
1066705969 10:38178257-38178279 CTCTTTGGAGCAAGGGAAAAGGG - Intergenic
1067109737 10:43391777-43391799 CTCAGTGGAGAAAGGGGAAAAGG - Intronic
1067694462 10:48524545-48524567 CCCCGCGCAGAATGGGAAGAAGG + Intronic
1067710672 10:48648949-48648971 CTCTGTGCAGTATGGAGAGATGG + Intronic
1068493580 10:57755990-57756012 CTACTTTCAGAAAGGGAAGAAGG - Intergenic
1068745511 10:60525889-60525911 TTATTTGCAGAAAGGGGAGATGG + Intronic
1069545116 10:69322114-69322136 GTTTGTTTAGAAAGGGAAGATGG + Intronic
1070261216 10:74857716-74857738 GTCTGTTTAGAAAGGAAAGAGGG + Intronic
1071705693 10:87996002-87996024 CTCTGTGGAGAAATAGTAGATGG - Intergenic
1072087290 10:92093193-92093215 CTGGGTGCAGAAAGGGAACCTGG + Intronic
1072543030 10:96412914-96412936 TTGTGTCCAGAAGGGGAAGAAGG - Intronic
1072702782 10:97656001-97656023 GTCTGTGCAGCTAGGAAAGAAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073427546 10:103464925-103464947 CTCAGAGAAGAATGGGAAGATGG - Intergenic
1073793223 10:106960808-106960830 TTCTGTGCAGGAATGGGAGAGGG + Intronic
1075533326 10:123248943-123248965 CTCTGTTCATCAAAGGAAGACGG - Intergenic
1075698644 10:124453971-124453993 CTCTATGCACAGAGGGAAGGTGG - Intergenic
1076192529 10:128492686-128492708 CTCTGTGGAGAAGGGGGAAAAGG + Intergenic
1076854222 10:133108044-133108066 ACATGTGGAGAAAGGGAAGAAGG - Intronic
1077398830 11:2342466-2342488 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
1077637773 11:3855413-3855435 CTCGGTGGGGAAAGGGAAGCTGG + Intronic
1077763532 11:5131848-5131870 GTGTGTGAAGAAAGAGAAGAAGG + Exonic
1078403240 11:11045826-11045848 CCCTGAGCAGGATGGGAAGAAGG - Intergenic
1079236341 11:18693376-18693398 CTGTAAGCAGAAAGGGCAGAAGG + Intronic
1081406809 11:42707759-42707781 CTCTCTTCACATAGGGAAGACGG - Intergenic
1081533875 11:43983502-43983524 CTCTGTGCTGTAAGGGGAGATGG + Intergenic
1082131056 11:48489803-48489825 TTCTTTGAAGAAAGGGAAGATGG - Intergenic
1082702442 11:56449463-56449485 GTCTGTGGAGCAGGGGAAGATGG + Intergenic
1082703961 11:56469684-56469706 GTCTGTGGAGCAGGGGAAGATGG - Exonic
1083009102 11:59377830-59377852 CTCTCTGCAAAAAAGGAAAAGGG + Intergenic
1083911700 11:65713583-65713605 CTCTCTGCAGAAACGGAAGGTGG + Exonic
1084875009 11:72124622-72124644 CTCTCAGCAGAAAGGGGAGCTGG + Intronic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1085641433 11:78195495-78195517 CTCTGTGGAGAAAGGGCAAGAGG - Intronic
1085652765 11:78283312-78283334 CTTTGTGCACAAATGGAAAAAGG - Intronic
1087175752 11:95093351-95093373 GTCTGTGTAGAAAGGGAATTTGG - Intronic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1087784750 11:102342045-102342067 CACCATGCAGAAGGGGAAGAAGG + Intergenic
1087852554 11:103049243-103049265 CTCTTTGGAGACAGGGAAAATGG - Intergenic
1088386858 11:109268042-109268064 TTCTGTTCAGAAAAGGAAGGTGG + Intergenic
1088773876 11:113062989-113063011 GTCTGTGAAGAATGGGAGGAAGG + Intronic
1088987079 11:114918572-114918594 CTCTTTGGAGAAGGGGAAGATGG + Intergenic
1089220409 11:116866294-116866316 GGCTGTGGAGGAAGGGAAGAAGG + Intronic
1090660521 11:128878813-128878835 CTCTGTGGAGAAAGGAAATCTGG + Intergenic
1090737621 11:129624101-129624123 CTCTGTGCATCCAGGGAAGCTGG + Intergenic
1091467552 12:698417-698439 CTTTCTGCAGAAAGTGAAAATGG + Intergenic
1092016230 12:5161137-5161159 CTCTCTCCAGAAAGGAAAAACGG + Intergenic
1092346044 12:7715367-7715389 GTCTGTGCAGAGAGAAAAGATGG + Exonic
1092632247 12:10394661-10394683 GTCTGTGTAGAAAGGGAGGAAGG + Intronic
1093151122 12:15623059-15623081 CTCTGTTAAGAAAGGGAAATTGG + Intronic
1093682065 12:22014139-22014161 TTCTGTGGGGGAAGGGAAGAGGG - Intergenic
1093990754 12:25587402-25587424 CTCACAGCAGAAAGGGAAGCAGG + Intronic
1095401657 12:41821113-41821135 CTCTGCCCTGAAAGAGAAGAAGG + Intergenic
1095929587 12:47612256-47612278 CTCAGAGCAGAAGGGAAAGAGGG - Intergenic
1095980270 12:47969071-47969093 CTCTGTCCTGGAAGGGAACAGGG - Intergenic
1096006676 12:48178966-48178988 GGCAGTGCAGAAAGGGGAGATGG + Intronic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1097454938 12:59787555-59787577 ATCTGTGGTGAAGGGGAAGAGGG + Exonic
1097577399 12:61412167-61412189 ATCTGTGCTGAAATGAAAGAAGG - Intergenic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1098581903 12:72109910-72109932 CTCTGTGCAGTCAGAGATGATGG + Intronic
1099137501 12:78925621-78925643 CTCTATGAAGAAAGGGAGGATGG - Intronic
1100272080 12:93035534-93035556 GTCTGTGCAGAGAGAGAGGATGG + Intergenic
1100372201 12:93978625-93978647 CTCTGTTCAGAAGGCAAAGAGGG - Intergenic
1100447929 12:94678470-94678492 CTTTTTGCAGATAGAGAAGAGGG - Intergenic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1101729733 12:107416967-107416989 TTCTCAACAGAAAGGGAAGAAGG - Intronic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102409452 12:112704599-112704621 CTCTGGGAAGAAAGAGATGATGG - Intronic
1102706069 12:114881616-114881638 CTCTGGGGTGAAAGGGAGGAAGG - Intergenic
1103054078 12:117804940-117804962 CTCTGGGCAGCAGGGAAAGATGG - Intronic
1103120411 12:118375643-118375665 CTCTGAGTAGAAAAGGAACACGG - Intergenic
1104391041 12:128390735-128390757 CTCTGTGCTGAATGGGGAAATGG + Intronic
1104780583 12:131417460-131417482 CCCTGTGCAGTAAGGTCAGAGGG - Intergenic
1105203559 13:18200271-18200293 CTCAGTGAAGAAAGGGCAAAGGG - Intergenic
1105614470 13:21999785-21999807 CTGGGTGCAGGAAGGCAAGAGGG + Intergenic
1106516706 13:30462685-30462707 CTCAGAGCAGAAGAGGAAGAAGG + Exonic
1106920206 13:34555350-34555372 CTCTCTGGAGAAAGGAGAGAGGG - Intergenic
1107221058 13:37980915-37980937 CACTGTGTAGAATGGGAAAATGG - Intergenic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1109781217 13:67112722-67112744 CCCTGTCAAGAAAGGAAAGAAGG - Intronic
1110449796 13:75628811-75628833 CTCTGTGTTGTAAAGGAAGAAGG - Intronic
1111410571 13:87871784-87871806 CTCTGTCCACCATGGGAAGAAGG - Intergenic
1111896627 13:94150163-94150185 ATTTGTGTAGGAAGGGAAGAGGG - Intronic
1112324957 13:98437958-98437980 CCCTGAGCAGAATGGGAAGGTGG + Intronic
1114369258 14:22067803-22067825 CTCCGTGCTGAGAGGAAAGATGG + Intergenic
1114491099 14:23102486-23102508 CTAACTGCAGAAAGGGAAGAAGG + Intergenic
1114975120 14:28086373-28086395 GTATATGCATAAAGGGAAGAAGG + Intergenic
1115739353 14:36371680-36371702 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1117066248 14:52015274-52015296 CTCTGAGCAGATGGGGAAGAGGG + Exonic
1117755719 14:58972230-58972252 CTCTGTGCAGAAAGGGGTCCTGG + Intergenic
1118328545 14:64798200-64798222 CTCTGTGCTGCAAGTGATGAGGG + Intronic
1118495711 14:66306335-66306357 CTCTGTGTAGGAAGGGACAAGGG + Intergenic
1118850249 14:69577556-69577578 CTCTGTCAAGAAAGGAAGGATGG + Intergenic
1121105913 14:91279668-91279690 CTCTGTGCAGTAATAGAGGAGGG - Intronic
1121302291 14:92881334-92881356 CTCTGTGCAAAGAGGGAGGTGGG - Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121743472 14:96269700-96269722 CTCTTTCCAAAAAGGGAATAAGG - Intergenic
1121878643 14:97478945-97478967 CCCAGGGCAGAAAGGGCAGAAGG + Intergenic
1121933072 14:97990971-97990993 CACTGAACAGGAAGGGAAGATGG + Intergenic
1122067853 14:99185946-99185968 ATCTGTGAAGGAAGGGAGGAAGG - Intronic
1122374610 14:101249480-101249502 CTCTGTGCAAAATGGGAATGTGG + Intergenic
1122689305 14:103524092-103524114 CTCTGTGAATAAAGCAAAGAAGG + Intergenic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1124491706 15:30162033-30162055 CTGTCTGCAGAAAGGGGAGGAGG - Intergenic
1124585863 15:31006044-31006066 CTCTGTGCTGAAAGGAAAGCTGG - Intronic
1124751830 15:32376276-32376298 CTGTCTGCAGAAAGGGGAGGAGG + Intergenic
1125677258 15:41509081-41509103 CTCTGGGCTGATGGGGAAGATGG - Exonic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1127758085 15:62112449-62112471 GACTGAGAAGAAAGGGAAGAGGG + Intergenic
1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG + Intronic
1128858710 15:71045888-71045910 CACTGTGCACACATGGAAGATGG - Intronic
1128871842 15:71165094-71165116 CTCAGAGCAGAAGAGGAAGAAGG + Intronic
1129536369 15:76316418-76316440 CTCTGTGCAGGAAGAGTGGATGG + Intergenic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131253140 15:90844080-90844102 CTCTGGGCTGAATGGGAAGGAGG - Intergenic
1131748486 15:95477855-95477877 ATCTGTGAAGAAAGTGAACAAGG + Intergenic
1131978003 15:97964843-97964865 CTTTGAGCAGAAATGGAAAAGGG - Intronic
1132919299 16:2376631-2376653 CTCTCTGGAGAGAGGGATGAGGG - Intergenic
1133575870 16:7088961-7088983 CTCTTTGCTGTAAAGGAAGAAGG + Intronic
1134215239 16:12312079-12312101 CTCTGAGCTGCAAGGGAAGCTGG + Intronic
1134282650 16:12831441-12831463 TTCTGTGCTGAAGGGAAAGACGG - Intergenic
1136284592 16:29233570-29233592 CTCAGAGCAGGAAGGGCAGAGGG + Intergenic
1136933822 16:34440515-34440537 CTATGTGCAGGAAAAGAAGAAGG - Intergenic
1136970750 16:34971299-34971321 CTATGTGCAGGAAAAGAAGAAGG + Intergenic
1137055132 16:35742051-35742073 CTCTGCCCAGGAAGGAAAGAAGG + Intergenic
1137312262 16:47274975-47274997 CTCTGTTCACTATGGGAAGAAGG + Intronic
1137859343 16:51830554-51830576 CTCTTTGAAGAATGAGAAGAAGG - Intergenic
1138077075 16:54053154-54053176 ATCTCTGCAGAGAGGAAAGATGG - Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1138825682 16:60316488-60316510 CTCTGAGAAGGAAGGGAGGAAGG - Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139558614 16:67728107-67728129 GTCTGTGCAGGCTGGGAAGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139966403 16:70747890-70747912 CTCTGTTCTGACAGGGAAGTAGG - Intronic
1140222450 16:73053770-73053792 CTCTGAGCTGAAAGGCAAGGCGG + Intronic
1140293887 16:73689400-73689422 CTATGTGCACAAAGTAAAGAGGG + Intergenic
1140436548 16:74951542-74951564 CTCTGAAAAGAAAGGAAAGAAGG + Exonic
1140493541 16:75362333-75362355 CACTGTGCTGAAAGGCAAGGGGG + Intronic
1141073204 16:80977426-80977448 CCCTGGGCAGAAGGGGAAAAGGG + Intronic
1141789581 16:86225453-86225475 CCCTGTGCAGAAAGGTGATAAGG + Intergenic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1142089624 16:88203083-88203105 CTCAGAGCAGGAAGGGCAGAAGG + Intergenic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1143964375 17:10746231-10746253 CTCTCTGAAGAAAGGAAGGAAGG + Intergenic
1144834370 17:18149195-18149217 CCCTGTGGAGAAAAGGAACATGG - Exonic
1146691414 17:34878752-34878774 GGCTGTGCAGAAATGGAAGGAGG - Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147670691 17:42175200-42175222 CACTGTGGGGAAAGGGAACAAGG - Intronic
1148022256 17:44561189-44561211 CACTGTTAAGAAATGGAAGATGG - Intergenic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148441426 17:47713564-47713586 CTCTGTGGAGACAGGGAGGCAGG + Intergenic
1148443236 17:47722487-47722509 CCCTCTGGAGAAAGGCAAGATGG - Intergenic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148959829 17:51384221-51384243 CTGTGTGCAAAAAGGAAACAGGG - Intergenic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1150365541 17:64580460-64580482 CACTGTATAGAAAGGTAAGATGG - Intronic
1151894933 17:76973703-76973725 CTCTGTACAGAAAGAAAGGAGGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152137767 17:78515083-78515105 GTAAGTGCAGAAAGGTAAGAGGG - Intronic
1153002119 18:465056-465078 TTCTGGGAAGAAAGGGGAGATGG + Intronic
1153307914 18:3649719-3649741 CACTGTGCAGAAATAGAAAAGGG + Intronic
1153398681 18:4656049-4656071 CTCTGTGCAGGAAAGAAAAATGG - Intergenic
1155079654 18:22396119-22396141 CACTGTTCAGAACGGGAATAGGG + Intergenic
1156370393 18:36467472-36467494 CTCTGCCCTGGAAGGGAAGAAGG - Intronic
1156547368 18:37978141-37978163 CTCATGGCAGAAAGGGAAGTTGG + Intergenic
1157254443 18:46125867-46125889 CACTGAGGAGAAAGGAAAGAAGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157600033 18:48888121-48888143 CACAGTGCAGAAAAGGAAGCCGG + Intergenic
1158565289 18:58549856-58549878 CTGTGTCCTGAAAGGGAAGCAGG + Intronic
1159521623 18:69532216-69532238 CTCTGTTCAGATAGGCAAGAGGG - Intronic
1159752887 18:72324728-72324750 CTGTGTGCAGACCAGGAAGAGGG + Intergenic
1164406842 19:27956581-27956603 CTCTTTGGAGCAAGGGAAAAAGG - Intergenic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1166051528 19:40263634-40263656 CTCTGTCCAGAAAGAGCAGCAGG + Intronic
1166566880 19:43770925-43770947 GTCTTTGGAGCAAGGGAAGAGGG - Intronic
1166657617 19:44623682-44623704 GTCTGTGCAAACAGGGAACAAGG - Intronic
1167623203 19:50569900-50569922 CTCCGAGGAGAAGGGGAAGAGGG - Intergenic
1168636407 19:58000537-58000559 CTCTGTGCAGAGCTGGAACAAGG - Intronic
925338166 2:3113982-3114004 CACTGTGAAGAAAGAGAAGCTGG + Intergenic
925947032 2:8874773-8874795 TTCTGTGCAGGAAGGGGAGGAGG - Intronic
926075003 2:9935424-9935446 CACTGTGGATAAAGGGGAGAGGG + Intergenic
926382883 2:12308667-12308689 CTCTGTTCAGAAAGTTAAGAAGG - Intergenic
926620134 2:15039991-15040013 CTCTCTGGAGACGGGGAAGATGG - Intergenic
927035254 2:19167687-19167709 CTCAGTGGAGAATGGGATGAAGG + Intergenic
927081479 2:19635007-19635029 GTCTGTGCAGACTGGGGAGAAGG - Intergenic
927115236 2:19893475-19893497 CACTCTACAGAAAGGAAAGAAGG - Intergenic
927186994 2:20488998-20489020 ATCAGTCCCGAAAGGGAAGAGGG - Intergenic
927208438 2:20624419-20624441 CTCTGTGCAGAGTTGGCAGAGGG - Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928538804 2:32264956-32264978 ACCAGTTCAGAAAGGGAAGATGG + Intronic
928931660 2:36631389-36631411 CTTTCTGCAGAAAGTAAAGATGG + Intronic
929051823 2:37843546-37843568 TTGTGTGGAAAAAGGGAAGAGGG - Intergenic
929141729 2:38672423-38672445 CTATTTTCAGAAAGAGAAGAAGG + Intronic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929619949 2:43344368-43344390 CTCTTTGCAGAAAGGCATGTTGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930754308 2:54959855-54959877 CTCTGTGGAGGAATGGAGGAAGG + Intronic
931958382 2:67453556-67453578 ATGAGTGCAGAAAGAGAAGAGGG - Intergenic
932176053 2:69603625-69603647 CTCTGTGTAGAAAGATAAGAGGG + Intronic
932609340 2:73187289-73187311 CTCTGTGCAGCAAGGACAAATGG + Intergenic
934150669 2:89144885-89144907 CTCTGTGGAGAAAAGGACTATGG - Intergenic
934216606 2:90037143-90037165 CTCTGTGGAGAAAAGGACTATGG + Intergenic
934473674 2:94578137-94578159 CTCTGCCCAGAAAGGGCACAGGG + Intergenic
935276370 2:101478838-101478860 CTCTCTGCAAAAAGGGAAACAGG - Intergenic
935670088 2:105547851-105547873 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
936071734 2:109375739-109375761 CCCTGTGCAGAAAGAGAGGGGGG - Intronic
936946986 2:117940055-117940077 CTCTGAGCAGCAAAGGAAGGTGG + Intronic
937057121 2:118948170-118948192 CTTTCTGCAGAAAGTAAAGATGG - Intronic
937057650 2:118952925-118952947 CTTTCTGCAGAAAGTAAAGATGG - Intronic
937081815 2:119145626-119145648 CTGTTTGGAGAAAGCGAAGAAGG + Intergenic
937243963 2:120480382-120480404 ATCGGTGCAGAGAGGGATGACGG + Intergenic
937609317 2:123840865-123840887 CTCTGTGCAGGAAGGTGAGGTGG - Intergenic
938101421 2:128500330-128500352 CTCAGTCCACACAGGGAAGAGGG + Intergenic
938158496 2:128961354-128961376 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
939147272 2:138431078-138431100 TGTTATGCAGAAAGGGAAGAAGG + Intergenic
939269196 2:139915488-139915510 CTCTCTGCAGCAATGGCAGATGG + Intergenic
939428992 2:142078319-142078341 CTCTCTGAAGCAAGGGAAGGAGG - Intronic
940087502 2:149877257-149877279 ATCGTTGCAGAAAGGGAAGCAGG - Intergenic
941832810 2:169980804-169980826 CTCTTTTCAGCAAGGGAGGAGGG - Intronic
942616663 2:177798052-177798074 CTCAATGCAGACAGGGAAAAGGG - Intronic
943312350 2:186342333-186342355 CTTTAGGCAGAAAGAGAAGAGGG + Intergenic
943880077 2:193131759-193131781 CTCTGTGCAGAATTGGGACATGG - Intergenic
945193563 2:207216108-207216130 GTGTGTGAAGAAAGGGAAGCAGG + Intergenic
945965638 2:216183652-216183674 TTCTGTTCTGAAAGGGAAGCAGG + Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946537803 2:220650359-220650381 CTCTGATGAGAAAGGGGAGAGGG - Intergenic
946543055 2:220706962-220706984 CTCTGGGAGGAAAGGGCAGAGGG - Intergenic
946879699 2:224164510-224164532 CTCTGTGCAGGAGTGGGAGATGG - Intergenic
947571819 2:231241873-231241895 GTCTGTGCAAAAAGGGAAACAGG + Intronic
947872796 2:233449105-233449127 CTCTGTCCTGAAAGAGAAGCTGG + Exonic
948167607 2:235875113-235875135 CTCCTTGCAGCAAGGGCAGATGG - Intronic
948650372 2:239439972-239439994 CTCTGTGCAGTCAGGGATGTAGG + Intergenic
948712503 2:239833753-239833775 GCCTGTGAAGAAGGGGAAGAGGG + Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170572441 20:17640221-17640243 CTCTGTGCAGAACAGGAACATGG + Intronic
1171400782 20:24871975-24871997 CTGTGCGCAGAAGGAGAAGAAGG + Intergenic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1173177986 20:40779064-40779086 CTTTGTGTAAAAAGGGAAGGAGG + Intergenic
1173315744 20:41941576-41941598 CTCTGTTCAGAGAGAGATGAAGG - Intergenic
1173904165 20:46613763-46613785 CTCGGGGCAGAAGGGGAAGGAGG + Intronic
1174301722 20:49587154-49587176 CTTTGTGCCGATAGAGAAGATGG + Intergenic
1174790013 20:53469531-53469553 CTCTGTCAAGAAAAGAAAGAAGG + Intronic
1175233153 20:57488704-57488726 CTCAGAGCAGAACAGGAAGAAGG + Intergenic
1176714411 21:10337806-10337828 CTCAGTGAAGAAAGGGCAAAGGG + Intergenic
1178634347 21:34289231-34289253 GTCTTGGCAGAAAGGGAAGGAGG + Intergenic
1179020265 21:37634348-37634370 CTCATTGCAGAAGGGGAAAAGGG - Intronic
1180033095 21:45225569-45225591 ATCTGTGCACAATGTGAAGACGG - Exonic
1180152206 21:45955269-45955291 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1180693614 22:17738217-17738239 CTCTGTGCAGGACCGGAACAGGG - Exonic
1181047345 22:20221864-20221886 CTCTGTGCACAAAGAGAGGTGGG + Intergenic
1181381747 22:22510019-22510041 CTTTCTGCAGAAAGTGAAAATGG - Intergenic
1181422547 22:22811807-22811829 ACCTGTGCAGAAAGTGAGGAGGG - Intronic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181716937 22:24737858-24737880 CTATGTGTAGAAAGAGAAGGGGG + Intronic
1181767993 22:25105684-25105706 CTCCTTCCAGAAAGGGGAGAGGG - Intronic
1182299888 22:29331449-29331471 CTTTGTGGAGGACGGGAAGATGG - Exonic
1182457174 22:30459304-30459326 CTATGTGCAACAAGGGAAGTGGG + Exonic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1183039935 22:35170325-35170347 TTCTATTCAGAAAGGGCAGAAGG - Intergenic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183499312 22:38168944-38168966 CTATATGGACAAAGGGAAGAAGG - Intronic
1184158465 22:42684219-42684241 TTCTGTGCAGAAGAGGGAGAGGG + Intergenic
949965696 3:9354304-9354326 CTCTCTGCAGGAGAGGAAGAAGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
951284116 3:20788512-20788534 CTCTGTGGACAAAGGGGAGGTGG - Intergenic
951412535 3:22382120-22382142 CTCAGAGCAGAAGAGGAAGAAGG - Intergenic
951746434 3:25982801-25982823 CTGTGTTCAGAAAAGGCAGATGG - Intergenic
952094949 3:29939672-29939694 ATCTGTGCAGGAAGAGAAGAAGG - Intronic
954469032 3:50675484-50675506 CTCTGTGCAGAGAGGGCGGCAGG + Intronic
956053865 3:65277840-65277862 CTCTTTGAAGCAAGGGAATAAGG - Intergenic
956110611 3:65866853-65866875 CTCGGTGTAAACAGGGAAGAAGG + Intronic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958845010 3:99255789-99255811 CTCTATGCAGTAGGGAAAGAAGG - Intergenic
959252187 3:103963229-103963251 CTCTGTGCAGAAAAGAGACAGGG - Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960093018 3:113660978-113661000 CTCTGAGCAGAAATGGCAGCAGG + Exonic
960588589 3:119344263-119344285 CTCTAATCAGAAAGGGAAGGAGG + Intronic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
962319128 3:134376503-134376525 CTCTCTGCAGAAAGAACAGAAGG + Intergenic
962756117 3:138466819-138466841 CTCAGGGCAGAAGGTGAAGAGGG + Intronic
963003087 3:140701548-140701570 CTATGTCCAGAAGGAGAAGAGGG - Intergenic
963066106 3:141265873-141265895 CTCAGAGCAGGAAGGGAAGTGGG + Intronic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
967028164 3:185582479-185582501 CTCTGAGCTGAAAGGGGATAAGG + Intronic
967194669 3:187016100-187016122 CTCTGTACAGAAAGAAAGGAAGG - Intronic
967343741 3:188429660-188429682 CTCTATTATGAAAGGGAAGACGG - Intronic
968967098 4:3774279-3774301 CTCTCTGCAGAGTGGGAAGGGGG - Intergenic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
969627460 4:8314853-8314875 CTCTGTCCTGAAAGAGAAGCTGG + Intergenic
969690691 4:8702511-8702533 GGCTGTACAGAAAGGGAAGGTGG + Intergenic
971254818 4:25004652-25004674 CTATGTGGTGAAAGGGCAGAGGG - Intronic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
973536724 4:51890467-51890489 CTCTGTGCTGAAACAGAAAAAGG - Intronic
973887594 4:55338966-55338988 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
973888125 4:55343291-55343313 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
974266668 4:59594822-59594844 CTCTGTGAAGAATCGGCAGAAGG - Intergenic
976768188 4:88620647-88620669 CTCTGTGGAGAGAGGGATTAAGG - Intronic
978165833 4:105605427-105605449 CCCTTTGCAGAAAGGGGAGTGGG - Intronic
978372504 4:108043084-108043106 CTCAGTGCTGAAAGGGTAGCTGG - Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
981602024 4:146500722-146500744 CTCTGTGATGAAAGGGAAAAGGG - Intronic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982547393 4:156751325-156751347 GTCTGTGGATAAAGGGTAGAGGG + Intergenic
985520556 5:372237-372259 CTCTGTGCAGTCAGGGGAGCTGG - Intronic
985731322 5:1550579-1550601 CCCTGTGCAGGCAGGGACGAGGG + Intergenic
985848456 5:2371382-2371404 CGCTGTGCAGAAAAGGAACCTGG - Intergenic
988452640 5:31358771-31358793 CTCTGTCAAGAAAGGAAGGAGGG - Intergenic
989767470 5:45104054-45104076 GTCAGTGCAGAAAGGAAATATGG + Intergenic
990376692 5:55177529-55177551 GTCTGGGCAGAATGGGAATAAGG - Intergenic
990627060 5:57625684-57625706 CTCTGTGCAGAAATGAAATTAGG - Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
990948729 5:61275889-61275911 CTCTGAGAACAAAGGGGAGAGGG - Intergenic
992080521 5:73231724-73231746 CTTTGTGCAGAAATGGGTGATGG - Intergenic
992445927 5:76833438-76833460 CTCAGAGAAGAAAAGGAAGAGGG + Exonic
992519450 5:77535263-77535285 TTCTGTGCAGAAGGGGAAGATGG - Intronic
993054772 5:82969183-82969205 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
993167972 5:84382615-84382637 CTCTTAGCAGGAAGGGAAGGGGG - Intronic
993915964 5:93742507-93742529 CTGTGTGCAGAAAGCTAAGGAGG + Intronic
994544316 5:101143796-101143818 ATCTTTGCAGAAGGGGAAGCAGG - Intergenic
995074202 5:107961844-107961866 GTCTGTGCAGATAGGTGAGAGGG + Intronic
995355573 5:111234262-111234284 CTTTGTGCAGAAAGGGGAAGTGG + Intronic
995964523 5:117888406-117888428 CCCTGTGCAAAAAGGGAAAGAGG - Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
997055436 5:130438189-130438211 TTCTGTGCAGAAAGGGTGCAAGG - Intergenic
997511723 5:134459058-134459080 CCCTCTCCAGAAAGGCAAGACGG - Intergenic
998552807 5:143093794-143093816 CTCTGAGAAGAAAGGAAAGGGGG + Intronic
998881128 5:146646066-146646088 TTCTGTGAAGACAGGGAATATGG - Intronic
999973869 5:156891714-156891736 CTCTGTGCAGAGAGGAAATATGG + Intergenic
1000185055 5:158851346-158851368 CGCTGTCAAGAAAGGGAAGAAGG + Intronic
1000680340 5:164176221-164176243 CTCTATGCAAAATAGGAAGATGG - Intergenic
1001228423 5:169965085-169965107 CTATGTGCAGCAATGGATGATGG - Intronic
1001258778 5:170207246-170207268 ATCTGTTCAGAAGGGCAAGAAGG + Intergenic
1001362066 5:171096845-171096867 CTCTGTGAAGAAGGGGTGGAGGG + Intronic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001753587 5:174149680-174149702 CTCTGTTCAGAGAGGGACAAGGG + Intronic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002023960 5:176384242-176384264 TTCTTTGCAGAAGAGGAAGATGG - Exonic
1002180867 5:177430543-177430565 CCCGGTGAAGAAAGGGGAGAAGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002426071 5:179176674-179176696 CTGTGTGCAGAAGGGGCAGGTGG - Intronic
1003258027 6:4490793-4490815 AGTTGTGAAGAAAGGGAAGAAGG + Intergenic
1003570676 6:7254381-7254403 CTCTGAGCAGTAAGGTAACAAGG - Intergenic
1003981995 6:11398480-11398502 CTCTGTGCAGGAGGTGAAGAAGG + Intergenic
1004195110 6:13496779-13496801 GTCTTATCAGAAAGGGAAGAAGG - Intergenic
1005360650 6:25027925-25027947 CTCTGAGAAGAAAGGGGAGTGGG + Intronic
1005418887 6:25629106-25629128 CTCTGCACAGCAAGGGACGAAGG + Intergenic
1005468272 6:26136728-26136750 CTCTGTGAAGAAAGAAAGGAAGG - Intronic
1006361419 6:33589389-33589411 ATCTGTGCAGAGAGGGCAGGAGG + Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1007599672 6:43074027-43074049 CCCAGTGGAGTAAGGGAAGAGGG + Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1008485491 6:52030642-52030664 CACCATCCAGAAAGGGAAGAAGG + Intronic
1008833191 6:55794278-55794300 CTCTGTGCAGAAACAGGGGATGG - Exonic
1010011455 6:71052054-71052076 CCCTGAGCAGAATGGGAAGGTGG - Intergenic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1011899531 6:92275085-92275107 CTCTCAGCAGGAAGGGAAGCTGG + Intergenic
1012141798 6:95634795-95634817 CTCTATCCAGAAAGGGATTAAGG - Intergenic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1012846731 6:104398879-104398901 CTCTGAGCAAAAAGGAAAAACGG + Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1014998099 6:128177984-128178006 ATCTGAGTAGAAAGGAAAGAGGG + Intronic
1016993132 6:149943051-149943073 CTCTTTCTAGAAAGGGAGGAAGG + Intronic
1017123302 6:151044243-151044265 CTCTGCCCAGAAAGGGCAGAGGG - Intronic
1017424810 6:154309473-154309495 CTCTGTGAAGAACGGTGAGATGG - Intronic
1018515018 6:164570014-164570036 CTCATTGCAGAAGGTGAAGAGGG + Intergenic
1020976468 7:15013015-15013037 TTCTGTGCAGACAGGGAATTTGG - Intergenic
1022266949 7:28766262-28766284 CCTTCTGAAGAAAGGGAAGAAGG + Intronic
1022456699 7:30564252-30564274 CTCTCTGCAGAAGAGGAATAGGG + Intergenic
1023990947 7:45127878-45127900 CTCTGTGCTGTCAAGGAAGAAGG - Intergenic
1024207292 7:47174721-47174743 CTCTGTGTAGAATGGGAAGCTGG - Intergenic
1024344630 7:48300684-48300706 TTCTCTGCAGCCAGGGAAGAGGG - Intronic
1024825917 7:53389092-53389114 CTCTGTACAGAAAGACAAAAAGG - Intergenic
1026011231 7:66638232-66638254 CTCTAAGCAGGAAGGAAAGAGGG - Exonic
1027052401 7:75028539-75028561 CTGAGTGCAGCAAGGGGAGAGGG - Intronic
1027637937 7:80699703-80699725 CTCAGTCAAGAAAGGGAAAAGGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1027948103 7:84777112-84777134 CTCATTGCAGAAGGTGAAGAGGG - Intergenic
1029129501 7:98319212-98319234 CTCTATAGAGCAAGGGAAGATGG + Intronic
1029452704 7:100650134-100650156 CACTGTGGAGAAAGTGCAGAGGG + Exonic
1029644411 7:101844474-101844496 CTCTGTGCAAAAAGAAAACAGGG - Intronic
1029788628 7:102819185-102819207 CTCTGTGGGGAAAGGCAACAAGG - Intronic
1029885735 7:103869085-103869107 CTCTGTGCATAAAGGGTTGGGGG + Intronic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1030776617 7:113541489-113541511 CTCTCTGCAAAATGGGAGGAGGG + Intergenic
1030994354 7:116340275-116340297 CTATGTGCAGAAGTGGAAGTGGG - Intronic
1031200188 7:118672898-118672920 ATCTCTGCAGGAAGCGAAGAAGG + Intergenic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1033781412 7:144674045-144674067 CACAGTGCAGGAAGGGAAAAGGG + Intronic
1033928827 7:146498303-146498325 CTCTGTGAAGTAATTGAAGATGG - Intronic
1034998089 7:155591053-155591075 CTCTCAGCAGAAAGGGAGGCTGG + Intergenic
1035775979 8:2188648-2188670 CACTGTGCAGAAAGGAAAACTGG - Intergenic
1035861622 8:3034921-3034943 CACTGTGGAGAAAGGGAAGGAGG + Intronic
1035990859 8:4488801-4488823 CTCTTTGCAGAGAGGAAATATGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036093018 8:5689972-5689994 CTTTGTGTACAAAGGTAAGATGG + Intergenic
1036836681 8:12076385-12076407 CTCTGTGAAGAATGGAAACAGGG - Intergenic
1036858524 8:12322953-12322975 CTCTGTGAAGAATGGAAACAGGG - Intergenic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1037959373 8:23084557-23084579 GTCAGTTCAGAAAGGGCAGAGGG + Intronic
1038313422 8:26463191-26463213 CTCTGTGAAGAAGAAGAAGAAGG - Intronic
1039961479 8:42251185-42251207 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1040554335 8:48466032-48466054 CTAGGTTTAGAAAGGGAAGACGG + Intergenic
1042515872 8:69658484-69658506 CTCTGTGAAAAGAGAGAAGAAGG - Exonic
1043451090 8:80367444-80367466 CTCAGAGAAGAAAGGAAAGAGGG - Intergenic
1044184913 8:89239761-89239783 CCCTGAGAAGAAAGGAAAGAGGG + Intergenic
1044212242 8:89563293-89563315 ATCTAGGAAGAAAGGGAAGATGG - Intergenic
1047037920 8:120959993-120960015 CTATGTTTAGAAAGGGTAGAAGG + Intergenic
1047051216 8:121115646-121115668 CACATTGCAGAAAGGGAAAAGGG - Intergenic
1048032867 8:130649578-130649600 GGCTGTGCAGAAGAGGAAGAGGG - Intergenic
1048205379 8:132411437-132411459 CTCTCAGCAGAAAGAGAAGGAGG + Intronic
1048408676 8:134149499-134149521 CTCTGTGAAGGAAAGGTAGATGG + Intergenic
1048410648 8:134168892-134168914 CTCTCAGCAGAAAGGGGACATGG + Intergenic
1048600519 8:135914602-135914624 TTCTAAGAAGAAAGGGAAGAAGG - Intergenic
1048601218 8:135920768-135920790 CTCACTGCAGAAAGTGAAGTGGG - Intergenic
1050106812 9:2174215-2174237 CTCTCTGAAGGAAGGGAAGGAGG + Intronic
1050126448 9:2361266-2361288 AGCAGTGCAGAAAGGTAAGAGGG - Intergenic
1051126218 9:13808797-13808819 GTTTATGCAGAAAGGGAAAATGG + Intergenic
1051715367 9:19977488-19977510 CTCTCTGCAGCAAGGTCAGAAGG + Intergenic
1053030318 9:34770713-34770735 TTAGGTGGAGAAAGGGAAGAGGG + Intergenic
1053583887 9:39436187-39436209 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1053684656 9:40510375-40510397 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1053934622 9:43138653-43138675 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054105468 9:60994931-60994953 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1054279070 9:63114590-63114612 CTCTGCCCAGAAAGGGCACAGGG + Intergenic
1054297750 9:63345837-63345859 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054395766 9:64650348-64650370 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054430410 9:65155543-65155565 CTCTGCCCAGAAAGGGCACAGGG - Intergenic
1054499970 9:65865978-65866000 CTCTGCCCAGAAAGGGCACAGGG + Intergenic
1055194405 9:73570090-73570112 CTCTTTGCAGAAATGATAGAAGG + Intergenic
1055983557 9:82031990-82032012 CTCTGTGCAGGAACTGAAGCTGG - Intergenic
1056907871 9:90669632-90669654 CTCTGTGCTAAAAGGGGAAATGG + Intergenic
1057090085 9:92250072-92250094 CTCACTGCAGAAAAGGAAAAAGG + Intronic
1057542793 9:95990927-95990949 CTCTCAGCAGAAAGGGAGGCTGG + Intronic
1059007031 9:110414076-110414098 CTCTGTTTTGAAAGTGAAGAAGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059367580 9:113798756-113798778 CCCTGTGCAGTAAATGAAGAGGG - Intergenic
1059963412 9:119589704-119589726 CTCTTAGCAGAAAGGAAAGCTGG - Intergenic
1059989099 9:119847833-119847855 CTCAGAGCAAATAGGGAAGATGG - Intergenic
1060155951 9:121319832-121319854 CACAGTGGAGAAGGGGAAGAGGG + Intronic
1060804010 9:126563704-126563726 CTCTGTACAGAGAGGGAAACAGG - Intergenic
1060867114 9:127009336-127009358 CTCTGTACAGTAAAGGGAGATGG - Intronic
1061527189 9:131175752-131175774 CTCTCTCCACAAAGGGGAGAGGG - Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061947390 9:133916382-133916404 CTCTTTGTAGAAAGGGAAGGTGG + Intronic
1185494889 X:546888-546910 CTCTGGGCAGAAATGGGATAAGG - Intergenic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1186596660 X:10988989-10989011 TTCTATGCAGAAAAGGAAGAAGG + Intergenic
1186780737 X:12909587-12909609 CTCAGTGCAGAAAGGGAACGTGG + Intronic
1187384304 X:18833349-18833371 CTCTCAGCAGAAAGGGAGGCTGG - Intergenic
1187410644 X:19048025-19048047 CTTTGGCCAGAACGGGAAGAAGG + Intronic
1188180599 X:27050658-27050680 CTCTCAGCAGACAGGGAAGCTGG - Intergenic
1188795706 X:34462012-34462034 CTATTTGCAGAAAGGTAAAATGG - Intergenic
1189416972 X:40824014-40824036 CCCTCTCCAGAAAGAGAAGATGG + Intergenic
1190152637 X:47960637-47960659 CACTGCCCAAAAAGGGAAGAGGG + Intronic
1191214167 X:57918829-57918851 CACTGAGCAGAAGGGGAAGAAGG - Intergenic
1191842608 X:65523875-65523897 CTCTGAGAAGAAAAGGAAAAGGG + Intronic
1192036398 X:67567480-67567502 CTCCGTGCAGAGATGGAAGTGGG + Intronic
1192773281 X:74215793-74215815 CCCTGTGCTGTTAGGGAAGAGGG - Intergenic
1193753208 X:85372918-85372940 CTCAGTGCAGTAAAGAAAGAAGG + Intronic
1194067338 X:89277477-89277499 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1194428497 X:93770709-93770731 CTTTGTGCAGAAAGTAAAAATGG - Intergenic
1195347086 X:103962000-103962022 GTCTGTGCAGAGAGAAAAGATGG - Intronic
1195360356 X:104076841-104076863 GTCTGTGCAGAGAGAAAAGATGG + Intergenic
1196048702 X:111282496-111282518 CTGTGTGCAGAAGGGCAAGATGG - Intergenic
1196266647 X:113656458-113656480 CCCTGTGCAGACAGGGAGGTGGG + Intergenic
1196668990 X:118346187-118346209 CTCCTCGCAGTAAGGGAAGAAGG - Exonic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198812603 X:140550834-140550856 CTCTGTGCACAAAGGAAGGTTGG + Intergenic
1199082000 X:143587566-143587588 CTTTCTGCAGAAAGTAAAGATGG - Intergenic
1199282600 X:146020078-146020100 CTTTCTGCAGAAAGTAAAGATGG + Intergenic
1199752387 X:150832682-150832704 CTCTCTGTAGGAAAGGAAGAAGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200721496 Y:6611691-6611713 CTCTGTGTAAAAGGGGAAGATGG - Intergenic
1201699776 Y:16867843-16867865 CTCTGCTTCGAAAGGGAAGAAGG + Intergenic