ID: 959702152

View in Genome Browser
Species Human (GRCh38)
Location 3:109308730-109308752
Sequence GTGGAGAATTTACAGTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959702152_959702163 17 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702163 3:109308770-109308792 TGTTGAAACTGTGCAGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 188
959702152_959702161 13 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702161 3:109308766-109308788 GGGTTGTTGAAACTGTGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 143
959702152_959702162 14 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702162 3:109308767-109308789 GGTTGTTGAAACTGTGCAGGGGG 0: 1
1: 0
2: 1
3: 15
4: 181
959702152_959702159 11 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702159 3:109308764-109308786 TTGGGTTGTTGAAACTGTGCAGG 0: 1
1: 0
2: 0
3: 48
4: 338
959702152_959702164 22 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702164 3:109308775-109308797 AAACTGTGCAGGGGGAGGAAAGG 0: 1
1: 2
2: 1
3: 37
4: 430
959702152_959702160 12 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702160 3:109308765-109308787 TGGGTTGTTGAAACTGTGCAGGG 0: 1
1: 0
2: 0
3: 37
4: 215
959702152_959702157 -7 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702157 3:109308746-109308768 TCTCCACTGGGAGAAATTTTGGG 0: 1
1: 0
2: 1
3: 23
4: 197
959702152_959702156 -8 Left 959702152 3:109308730-109308752 CCCATAAACTGTAAATTCTCCAC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 959702156 3:109308745-109308767 TTCTCCACTGGGAGAAATTTTGG 0: 1
1: 0
2: 3
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959702152 Original CRISPR GTGGAGAATTTACAGTTTAT GGG (reversed) Intronic
902791751 1:18773623-18773645 GTGGAAAATGTACATTTTAATGG - Intergenic
903248230 1:22032649-22032671 GTGGAGAAGTGACATTTTAATGG + Intergenic
904391222 1:30187526-30187548 GTGGAGAATTAACTAATTATAGG - Intergenic
906655880 1:47548143-47548165 GTGGAGAGTTGACATGTTATAGG - Intergenic
908226182 1:62058163-62058185 GTGGAGATTTTAGAATTTACAGG + Intronic
908522919 1:64962138-64962160 GTGTGGAATTTACAGTCTAGTGG - Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909793913 1:79709192-79709214 GTTGTGAATTTACAGCTGATGGG + Intergenic
911023645 1:93413762-93413784 GATGAGAATTTACGGTTTGTAGG + Intergenic
913289911 1:117262429-117262451 GATGAGAAATTACAGTTTAGGGG - Intergenic
913310009 1:117480231-117480253 CTGGGGAAGCTACAGTTTATAGG - Intronic
913647628 1:120874366-120874388 ATGGACAATTAAGAGTTTATTGG - Intergenic
914079008 1:144388494-144388516 ATGGACAATTAAGAGTTTATTGG + Intergenic
914100171 1:144578008-144578030 ATGGACAATTAAGAGTTTATTGG - Intergenic
914173912 1:145257041-145257063 ATGGACAATTAAGAGTTTATTGG + Intergenic
914298819 1:146359674-146359696 ATGGACAATTAAGAGTTTATTGG + Intergenic
914528572 1:148498226-148498248 ATGGACAATTAAGAGTTTATTGG + Intergenic
914637820 1:149568881-149568903 ATGGACAATTAAGAGTTTATTGG - Intergenic
915672499 1:157502185-157502207 GATGAGAATTTATAGTTTGTAGG + Intergenic
916045456 1:160996865-160996887 CTGGAAAATTTATTGTTTATTGG + Exonic
916334102 1:163650608-163650630 GAGGAGAATTTTCTGTTCATGGG - Intergenic
917122664 1:171657862-171657884 ATGGAGGCTATACAGTTTATAGG + Intergenic
918852117 1:189705804-189705826 ATGGATAAATTATAGTTTATAGG - Intergenic
918853538 1:189721990-189722012 GGTGAGAATTTATGGTTTATAGG - Intergenic
919870460 1:201817038-201817060 GTGGGGAATTAACAGATTAGAGG - Intronic
923692127 1:236204820-236204842 TTCTAGATTTTACAGTTTATTGG + Intronic
923882696 1:238120912-238120934 ATGAAGAGATTACAGTTTATAGG - Intergenic
1064040250 10:11956258-11956280 GTGGAGAATTTATTATTTCTAGG - Intronic
1065764202 10:29011453-29011475 GTGGAGAATCGACAGTGTTTTGG + Intergenic
1068111373 10:52684525-52684547 GTTTAGAAATTACAGTTTAGGGG - Intergenic
1068154393 10:53178328-53178350 GTGGACAATGTATATTTTATTGG - Intergenic
1068442254 10:57072875-57072897 GATGAGAATATAAAGTTTATAGG - Intergenic
1069185709 10:65420062-65420084 GATGAGAATTTACGGTTTGTAGG - Intergenic
1070215970 10:74381046-74381068 GTGGAAAATTTTCAGTGTATGGG + Intronic
1072823511 10:98582696-98582718 ATGGAGTATTTACATTTTACAGG + Intronic
1072848345 10:98858252-98858274 TGGCAGAATTTACAGTTTCTGGG - Intronic
1075173920 10:120142243-120142265 GTGGAACATATACAGTCTATGGG + Intergenic
1076838893 10:133035144-133035166 GATGAGAATTTACGGTTTGTAGG - Intergenic
1077714561 11:4568694-4568716 GATGAGAATTTATGGTTTATAGG + Intergenic
1078192817 11:9106423-9106445 ATGGAGAATTTACAGCTTTATGG - Intronic
1079379801 11:19927829-19927851 GTGGAGAAGTGGCTGTTTATTGG + Intronic
1080525796 11:33116004-33116026 CTGGATAATTGAAAGTTTATAGG - Intronic
1081101125 11:39003895-39003917 ATGGAGATTTTACAGATTACTGG + Intergenic
1085874320 11:80387697-80387719 TTGAAGAAATTACAGTTTATTGG + Intergenic
1086963636 11:93005849-93005871 GATGAGAACTTACAGTTTGTGGG - Intergenic
1087584413 11:100100174-100100196 GTGCAGAATTTACAGTGCATTGG - Intronic
1088213001 11:107476678-107476700 GTGGATAATTAAGAGTTGATTGG - Intergenic
1093869357 12:24269094-24269116 CTTGACAATTTACAGTATATTGG + Intergenic
1094106251 12:26814732-26814754 AAGGAGATTTTACTGTTTATTGG - Intronic
1094389218 12:29931338-29931360 GAGGAGACTCTACAGGTTATTGG - Intergenic
1094588872 12:31802376-31802398 GATGAGAATTTATAGTTTGTAGG + Intergenic
1094618332 12:32056466-32056488 GATGAGAATTTATAGTTTGTAGG - Intergenic
1096049288 12:48593052-48593074 GATGAGAATTTATAGTTTGTAGG - Intergenic
1097559707 12:61188181-61188203 GTGAAGAATTGAAAGTTTACAGG - Intergenic
1098076098 12:66733342-66733364 GTAGAAAATGTATAGTTTATTGG - Intronic
1100189210 12:92172818-92172840 GTGGAGAATTTACAAGTCTTTGG - Intergenic
1100261387 12:92935539-92935561 GATGAGAATTTACGGTTTGTAGG - Intergenic
1100619268 12:96255878-96255900 GATGAGAATTTACGGTTTGTAGG + Intronic
1103876516 12:124131660-124131682 GATGAGAAGTTACAGTTTAGGGG + Intronic
1105690109 13:22829007-22829029 TTGTAGAATATACAGTTTAGTGG - Intergenic
1106083538 13:26520500-26520522 GTGAAGTATTTATAGTTTAAGGG - Intergenic
1108253841 13:48592012-48592034 GGGGAGAGTTTACAGGTCATAGG + Intergenic
1110954303 13:81534712-81534734 GTGGAGTAATTAGAGTTAATAGG - Intergenic
1111099390 13:83562879-83562901 TTTGAGAATTTACATTTTTTTGG - Intergenic
1111226832 13:85285277-85285299 GTGGACATTTTACAGTGAATAGG - Intergenic
1112618521 13:101030723-101030745 TTGGAGAAATTCCAATTTATTGG + Intergenic
1112703965 13:102044831-102044853 GTAGATCATTTACAGTTTAATGG + Intronic
1112873582 13:104006457-104006479 GACGAGAATTTACTATTTATGGG - Intergenic
1113213165 13:108006351-108006373 TTGGTGAATATACAGATTATTGG + Intergenic
1114950146 14:27740204-27740226 GAGGAGAATTTCAAGGTTATTGG + Intergenic
1115282018 14:31674834-31674856 GTATAAAAGTTACAGTTTATTGG + Intronic
1116612081 14:47088556-47088578 GTGGTGAATTTCCAGTTACTGGG - Intronic
1116815357 14:49578873-49578895 GTTGAACATTTACAGTTTAGTGG + Intronic
1118643837 14:67818525-67818547 GTTTAGAAATTACAGTTTAGAGG + Intergenic
1118941548 14:70344233-70344255 GATTAGAAATTACAGTTTATGGG - Intronic
1120425048 14:84336984-84337006 GATGAGAATTTATGGTTTATAGG - Intergenic
1121702778 14:95968471-95968493 GTGGAAAATTTACAGTCAAAGGG - Intergenic
1124047925 15:26167700-26167722 AGGCATAATTTACAGTTTATGGG + Intergenic
1125073239 15:35581388-35581410 GGGGACTATTTACAGTTTAATGG + Intergenic
1126370581 15:47941792-47941814 GGGGAGAATTTACCTTTTAGTGG - Intergenic
1126551494 15:49935699-49935721 GTACATAATTTACAGTTTTTGGG - Intronic
1126640717 15:50823271-50823293 GTGTAGAATGTATAGTTTGTTGG + Intergenic
1130692305 15:86093455-86093477 GTGCAGTATTTTCAGTTTCTGGG - Intergenic
1131753262 15:95532770-95532792 CTGGATAATTTACAGTGTATGGG - Intergenic
1133119164 16:3595698-3595720 GTGGAGGATTCACAGGTTAAAGG + Intronic
1133404102 16:5509396-5509418 TTGGGAAATTTACAGTTCATGGG - Intergenic
1133758844 16:8782067-8782089 GGGCAGAATTCACAGTTTAGGGG - Exonic
1133800149 16:9078749-9078771 GATGAGAATTTACGGTTTGTAGG + Intergenic
1136917523 16:34220611-34220633 GTGGAAAATTTAGAGTTTTGAGG + Intergenic
1137746790 16:50827744-50827766 GTGGTGAATTTACACATTTTTGG + Intergenic
1139153565 16:64413820-64413842 ATGGAGAGTTCACAGTTTCTTGG - Intergenic
1140577389 16:76186907-76186929 GTAGAGAATTAGCAGTTTTTTGG - Intergenic
1143360483 17:6365194-6365216 ATGGAGAATTTTCTGTTCATTGG - Intergenic
1151046753 17:70929576-70929598 GTGGAAAAAATACTGTTTATAGG - Intergenic
1155699867 18:28730781-28730803 GTTTAGAAATTACAGTTTAGGGG + Intergenic
1156658274 18:39313569-39313591 GTAGTGATTTTACAGTCTATTGG + Intergenic
1159331887 18:67005546-67005568 GTGGGGAAATTACAGTTAACAGG - Intergenic
1159369193 18:67509743-67509765 GTGGAGTAATTACAATGTATTGG - Exonic
1162582072 19:11537636-11537658 GTTGAGGATATGCAGTTTATCGG - Intergenic
1168216432 19:54929554-54929576 GTGGAGACTTTGCATTTTCTGGG + Intronic
1168454937 19:56499424-56499446 GATGAGAATTTATAGTTTGTAGG - Intergenic
925252054 2:2447682-2447704 GTGGAGAAGTTGCAGATTCTAGG + Intergenic
925698644 2:6610562-6610584 CTGTAGATTTTACAATTTATTGG + Intergenic
925813035 2:7719890-7719912 GTGGAGAATGTCCAGGTTCTTGG - Intergenic
928879390 2:36080456-36080478 GTTGAGTATTTACTGTGTATAGG - Intergenic
930494833 2:52127806-52127828 GAGCACAGTTTACAGTTTATAGG + Intergenic
932005164 2:67920285-67920307 GTGGAGAATGAGCAGGTTATTGG - Intergenic
934155668 2:89197753-89197775 GATGAGAATTTATAGTTTGTAGG - Intergenic
934211656 2:89985006-89985028 GATGAGAATTTATAGTTTGTAGG + Intergenic
937184805 2:120030254-120030276 GATGAGAAATTACAGTTTAGGGG + Intronic
939707311 2:145471028-145471050 GTGGAGAATGGACTGTTTAAAGG - Intergenic
939767589 2:146270718-146270740 AAGGATAATTTAGAGTTTATAGG + Intergenic
940200505 2:151144726-151144748 ATGGAGAATTTACTGTATGTTGG + Intergenic
941395751 2:164970637-164970659 TTAGATAATTTACATTTTATTGG - Intergenic
941495292 2:166193126-166193148 GTGTAAAATTTAGAATTTATGGG - Intergenic
942993084 2:182226358-182226380 GTGGAGAAAGTACTATTTATGGG - Intronic
943172278 2:184417524-184417546 GTGGGGAATTTCTAGTATATAGG - Intergenic
944934360 2:204552265-204552287 GTGGAGCATTTAAGGTTTAAAGG - Intronic
945966088 2:216188532-216188554 ATGGAGAATTTAGAGTCTCTAGG + Intronic
946844561 2:223847926-223847948 GATGAGAATTTATGGTTTATAGG + Intergenic
947961662 2:234243870-234243892 GTGGAGAGTGTCCAGTTTCTTGG + Intergenic
1168843813 20:928189-928211 GAGGAGAATTTATGGTTTGTAGG + Intergenic
1174679996 20:52397167-52397189 GTTGGGAATTTAAATTTTATTGG + Intergenic
1176982033 21:15393482-15393504 GTGGAGTCTTTACATTTTCTAGG + Intergenic
1178766689 21:35460126-35460148 GTTGAGAATTTAAATTTTAAAGG + Intronic
1179287285 21:39988669-39988691 GTGAAGAATTTACACTGTAATGG + Intergenic
1181782648 22:25204242-25204264 GTGGAGAACTTAAAGTATTTTGG - Intronic
1182580051 22:31302327-31302349 GTGGAGCATTTCCACTTTCTAGG + Intergenic
1183644476 22:39115893-39115915 GATGAGAATTTATGGTTTATAGG - Intergenic
1183710115 22:39498400-39498422 GTGGAGATTTTACAGGTGAATGG + Intergenic
1184774048 22:46614665-46614687 GTCCAGAATTTATACTTTATGGG + Intronic
951840931 3:27033356-27033378 GTGGAGAATTGAAATTTGATAGG - Intergenic
952232022 3:31442057-31442079 TTGGAGAATTTATAGAGTATGGG + Intergenic
952247332 3:31608390-31608412 GTGGATATTTTAGAGGTTATTGG + Intronic
955297909 3:57750118-57750140 GTGAAGAATCTACAGATGATTGG + Intergenic
955791302 3:62591237-62591259 GTGGAGATTTTACAGTCCAGTGG + Intronic
956563425 3:70609689-70609711 GTGTAGAATTTACATAATATAGG - Intergenic
958908726 3:99969776-99969798 GTGAGGAATTTATAGTTTATTGG + Intronic
959316708 3:104817810-104817832 ATGGAGCTTTTACAGTTTGTAGG - Intergenic
959702152 3:109308730-109308752 GTGGAGAATTTACAGTTTATGGG - Intronic
960198754 3:114805010-114805032 ATGGAGAATTTATAGATTAAAGG - Intronic
960661220 3:120061174-120061196 GTGAGGAATTTACTGTTTATAGG + Intronic
961383017 3:126508253-126508275 GTGGGGAAATTTCAGGTTATAGG - Intronic
962272397 3:133987489-133987511 GGGGAGGACTTCCAGTTTATAGG - Intronic
964475394 3:157093148-157093170 CTAGAGAAATTACATTTTATTGG + Intergenic
964878282 3:161394628-161394650 TTGGAGACTTTCTAGTTTATGGG + Intergenic
965414839 3:168380309-168380331 CTGGAGATTTTCCAATTTATTGG + Intergenic
965679825 3:171238422-171238444 AGGGAGAATTTACATTTTTTGGG - Intronic
967073909 3:185985086-185985108 CTAAAGAATTTACAGTTTAAAGG - Intergenic
970444080 4:16109539-16109561 TTGCAGAATTTACATTTCATGGG - Intergenic
971543913 4:27860098-27860120 GGGGAGAATTTATAGTGTAGAGG - Intergenic
971713538 4:30147833-30147855 GATGAGAATTTATAGTTTGTAGG - Intergenic
973255646 4:48109663-48109685 GTGGATAATGTAGACTTTATTGG - Intronic
974627800 4:64446148-64446170 GAGGAGAATTTACGGTTTGTAGG + Intergenic
975065312 4:70055514-70055536 ATCGAGAATTTCCATTTTATGGG + Exonic
975250433 4:72172565-72172587 GATGAGAATTTATGGTTTATAGG - Intergenic
979666914 4:123321951-123321973 GTGGAGAATTTTCATCTTCTTGG - Intergenic
980684429 4:136207818-136207840 TTAGAGAATTTACAGATAATAGG + Intergenic
983628332 4:169825746-169825768 GTGGAGGCTTTACATTTTCTGGG - Intergenic
986646868 5:9925300-9925322 GGTGAGAATTTATAGTTTGTAGG - Intergenic
989668686 5:43888330-43888352 GTGGAGAATTTACAGATGTTGGG - Intergenic
989978889 5:50617743-50617765 ATGGACAATTAAGAGTTTATTGG - Intergenic
990109000 5:52300012-52300034 TTGGAGCATTTTCAGTTTAAAGG + Intergenic
990850978 5:60204687-60204709 ATTGAGTCTTTACAGTTTATTGG - Intronic
992009532 5:72512772-72512794 GATTAGAAATTACAGTTTATGGG - Intergenic
994062820 5:95499807-95499829 AAGGATAATTTACATTTTATAGG + Intronic
994749904 5:103725076-103725098 CTGGAGCATTTACAGTATACAGG - Intergenic
994845465 5:104983046-104983068 TTGTAGATTTTCCAGTTTATTGG + Intergenic
995459113 5:112384494-112384516 GTGGAGATTTTACTGATGATTGG - Intronic
996039998 5:118798675-118798697 GTGGAGAATGTTCAATATATTGG + Intergenic
996487893 5:124058124-124058146 AGGGAGAATGTACAGTGTATGGG + Intergenic
998066671 5:139164835-139164857 GATGAGAATTTACTGTTTGTAGG - Intronic
998500549 5:142628773-142628795 ATGGAGAATTTTGAATTTATTGG + Intronic
998811383 5:145969957-145969979 GTAGAGAATTTTCAGATTAAGGG - Intronic
999455435 5:151712314-151712336 GTAGAGATTTTTCACTTTATTGG + Intergenic
1000096815 5:157978491-157978513 GTGGAGAGTTTCCAGTTTCCAGG - Intergenic
1000212053 5:159116398-159116420 GTGGAGCATGTAGAGGTTATGGG + Intergenic
1002539778 5:179898748-179898770 ATGCAGAATATACAGTTTAAAGG - Intronic
1003453891 6:6262759-6262781 GTGCAGATTTTCCAGTTTAATGG - Intronic
1005283696 6:24302107-24302129 GAGGAAAATCTACAGTTTCTAGG + Intronic
1005703551 6:28428914-28428936 CTGAGGAATTTAAAGTTTATAGG - Intergenic
1008006112 6:46411060-46411082 GAGAAGAACTTACAGTTTCTGGG + Intronic
1008104088 6:47424331-47424353 GAGGTGAATTTAAAGTATATGGG - Intergenic
1008904922 6:56666640-56666662 GTGGAAAATGTCCATTTTATTGG - Intronic
1011757077 6:90510664-90510686 GTGGAGGATTGAAAGGTTATAGG - Intergenic
1012569454 6:100704433-100704455 CTGGAGAATATAAACTTTATAGG + Intronic
1012579616 6:100850614-100850636 GTAGAAGATTAACAGTTTATAGG + Intronic
1014374520 6:120656668-120656690 ATGGAGAATTGAGAATTTATGGG + Intergenic
1014505717 6:122252377-122252399 ATGGAGCATTTATATTTTATAGG + Intergenic
1015281746 6:131441996-131442018 GGGGAGAATTTTTAGGTTATGGG - Intergenic
1015743697 6:136486700-136486722 CTTGTGAATTTACAGTTTACAGG + Intronic
1016295088 6:142565256-142565278 GTGGGGAGTTTCCAGTTTATAGG + Intergenic
1016547184 6:145237624-145237646 GATGAGAATTTATAGTTTGTAGG - Intergenic
1017445420 6:154503121-154503143 GTGGAGATTTTATTGTTGATGGG - Intronic
1018747846 6:166776136-166776158 GTGGAGAAAGTACAGCTTAGAGG + Intronic
1019917447 7:4142998-4143020 TTGGGGAATTTACATTTTAAGGG + Intronic
1020632857 7:10661101-10661123 GTGGAAGATTTACACTTTAGGGG - Intergenic
1021050253 7:15974391-15974413 GTGGAAAATTTAGATTTTATTGG - Intergenic
1022408948 7:30121326-30121348 ATGAAAAACTTACAGTTTATTGG + Intronic
1022623188 7:32006261-32006283 GTGGAGTAGTTTCACTTTATAGG + Intronic
1026441251 7:70446297-70446319 GGGGAGAATATAGTGTTTATCGG + Intronic
1026865001 7:73818275-73818297 GTGGAGAATGTCCTGTTCATAGG - Intronic
1027602848 7:80260542-80260564 GTGGATATTTGACAGTTTTTTGG - Intergenic
1028883048 7:95901486-95901508 CTGTTGAATTTACAGATTATTGG - Intronic
1029027990 7:97438107-97438129 CTGGATATTTTAAAGTTTATAGG + Intergenic
1033934290 7:146564015-146564037 GTGTAGAATTTACAGAATATGGG - Intronic
1033983756 7:147197442-147197464 GTGGAGGATGTACAGGTTCTTGG - Intronic
1035550197 8:517314-517336 GGGGAGAATTTACATTCTATGGG + Intronic
1036058970 8:5293576-5293598 TTGGAAAATTTACAGATTCTTGG - Intergenic
1038576834 8:28711858-28711880 GGGGAGAATTGAGAGTTTGTAGG + Intronic
1039550654 8:38440658-38440680 GTGGAGTTTTTACATTTTAATGG - Intronic
1039993872 8:42514356-42514378 GGGGAGAACTGTCAGTTTATAGG + Intronic
1041317677 8:56581514-56581536 GTGGAGAGCTTACAGGCTATAGG - Intergenic
1042387076 8:68189011-68189033 GTGGGGAGTTTACATTTTAGTGG + Intronic
1042561321 8:70073713-70073735 GTACAGAATTTCCATTTTATAGG + Intergenic
1043718505 8:83513389-83513411 GATGAGAATTTACGGTTTGTAGG + Intergenic
1043753027 8:83965104-83965126 TTGTTGAATTTACAGTTTAATGG + Intergenic
1045777164 8:105818556-105818578 TTCTAGAATTTCCAGTTTATCGG + Intergenic
1048601621 8:135924322-135924344 TCTGAGAATTTACAGTTTAAGGG - Intergenic
1050206554 9:3202483-3202505 TTGGAGAATTTACATTCTATGGG - Intergenic
1051565672 9:18495179-18495201 TTAGAGGATTTACAGTTTAGTGG - Intronic
1053301824 9:36957915-36957937 GTGGAAAAGTTTCAGTCTATTGG - Intronic
1055155680 9:73060182-73060204 GTGCAGAATTTACAGTTTGTGGG - Intronic
1058682894 9:107455636-107455658 TGGGGGAATTTACAGTTTACAGG - Intergenic
1059550166 9:115221022-115221044 GCTGAGTGTTTACAGTTTATAGG + Intronic
1059902512 9:118943951-118943973 TTGGCTAATTTACTGTTTATAGG - Intergenic
1186012864 X:5156467-5156489 GATGAGAATTTATGGTTTATAGG - Intergenic
1187730732 X:22251781-22251803 GTGGATAATATACAGTGTCTGGG + Intergenic
1188213422 X:27449883-27449905 GTGGAGAACATACAGTATTTTGG - Intergenic
1188876129 X:35432187-35432209 GATGAGAATTTATGGTTTATAGG + Intergenic
1189664610 X:43340431-43340453 GTTGAGAATTTTTAATTTATTGG + Intergenic
1190810704 X:53880733-53880755 GATGAGAATTTATAGTTTGTAGG - Intergenic
1193481089 X:82029868-82029890 TTGGAGAAAATACAATTTATGGG - Intergenic
1195143387 X:101987064-101987086 GTGGAGAGTGTCCAGGTTATTGG - Intergenic
1196174107 X:112621509-112621531 TTGTAGAATTTACATTTTAGTGG + Intergenic
1196244320 X:113381689-113381711 GTAGAGACTTTTCACTTTATAGG - Intergenic
1196644331 X:118100315-118100337 CTGGAATTTTTACAGTTTATTGG + Intronic
1197699321 X:129586304-129586326 GTCCAGAAGTTACAGTTTCTAGG - Intronic
1198714437 X:139541696-139541718 GTGGAGAATTCCCATTATATGGG - Intronic
1199089843 X:143678923-143678945 GAGGTGAATGTACATTTTATTGG + Intergenic
1199634582 X:149803397-149803419 GTGGAGAAATCACAGTCGATGGG + Intergenic
1201326556 Y:12766570-12766592 GTGGAGCATTAACACTTTATAGG + Intronic