ID: 959710574

View in Genome Browser
Species Human (GRCh38)
Location 3:109381921-109381943
Sequence CTGAATGTACAAATGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959710571_959710574 16 Left 959710571 3:109381882-109381904 CCTTCCCTGCAAAATGGCATCAC No data
Right 959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG No data
959710570_959710574 20 Left 959710570 3:109381878-109381900 CCTTCCTTCCCTGCAAAATGGCA No data
Right 959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG No data
959710572_959710574 12 Left 959710572 3:109381886-109381908 CCCTGCAAAATGGCATCACACAT No data
Right 959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG No data
959710573_959710574 11 Left 959710573 3:109381887-109381909 CCTGCAAAATGGCATCACACATG No data
Right 959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959710574 Original CRISPR CTGAATGTACAAATGAAAAA TGG Intergenic
No off target data available for this crispr