ID: 959712977

View in Genome Browser
Species Human (GRCh38)
Location 3:109403242-109403264
Sequence AATCAGGTTTACGTGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959712977_959712989 19 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712989 3:109403284-109403306 TCCAAATGGGATCACATTGGGGG No data
959712977_959712988 18 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712988 3:109403283-109403305 CTCCAAATGGGATCACATTGGGG No data
959712977_959712982 5 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712982 3:109403270-109403292 ACCAAATCGCCATCTCCAAATGG No data
959712977_959712984 6 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712984 3:109403271-109403293 CCAAATCGCCATCTCCAAATGGG No data
959712977_959712991 24 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712991 3:109403289-109403311 ATGGGATCACATTGGGGGTTAGG No data
959712977_959712986 16 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712986 3:109403281-109403303 ATCTCCAAATGGGATCACATTGG No data
959712977_959712987 17 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712987 3:109403282-109403304 TCTCCAAATGGGATCACATTGGG No data
959712977_959712992 25 Left 959712977 3:109403242-109403264 CCTTGCCCCACGTAAACCTGATT No data
Right 959712992 3:109403290-109403312 TGGGATCACATTGGGGGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959712977 Original CRISPR AATCAGGTTTACGTGGGGCA AGG (reversed) Intergenic
No off target data available for this crispr