ID: 959726552

View in Genome Browser
Species Human (GRCh38)
Location 3:109549393-109549415
Sequence AGATCTGAGCTGCATGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959726546_959726552 22 Left 959726546 3:109549348-109549370 CCGTATTCTAGGCAACCTAGTTC No data
Right 959726552 3:109549393-109549415 AGATCTGAGCTGCATGTCACAGG No data
959726548_959726552 7 Left 959726548 3:109549363-109549385 CCTAGTTCAAGAGTGCCTTGGTC No data
Right 959726552 3:109549393-109549415 AGATCTGAGCTGCATGTCACAGG No data
959726545_959726552 23 Left 959726545 3:109549347-109549369 CCCGTATTCTAGGCAACCTAGTT No data
Right 959726552 3:109549393-109549415 AGATCTGAGCTGCATGTCACAGG No data
959726550_959726552 -8 Left 959726550 3:109549378-109549400 CCTTGGTCCTGAAGGAGATCTGA No data
Right 959726552 3:109549393-109549415 AGATCTGAGCTGCATGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959726552 Original CRISPR AGATCTGAGCTGCATGTCAC AGG Intergenic