ID: 959732474

View in Genome Browser
Species Human (GRCh38)
Location 3:109619648-109619670
Sequence ATAAGCTATATTGCCAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959732474_959732477 26 Left 959732474 3:109619648-109619670 CCTTGCTTGGCAATATAGCTTAT No data
Right 959732477 3:109619697-109619719 GAGAAGCCTGATAGTATACTGGG No data
959732474_959732476 25 Left 959732474 3:109619648-109619670 CCTTGCTTGGCAATATAGCTTAT No data
Right 959732476 3:109619696-109619718 AGAGAAGCCTGATAGTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959732474 Original CRISPR ATAAGCTATATTGCCAAGCA AGG (reversed) Intergenic
No off target data available for this crispr