ID: 959733298

View in Genome Browser
Species Human (GRCh38)
Location 3:109628681-109628703
Sequence GATGGAGAGCAGACCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959733290_959733298 11 Left 959733290 3:109628647-109628669 CCATCAGCCATCTGCATAGAGGT No data
Right 959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG No data
959733292_959733298 4 Left 959733292 3:109628654-109628676 CCATCTGCATAGAGGTCAAGGTC No data
Right 959733298 3:109628681-109628703 GATGGAGAGCAGACCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959733298 Original CRISPR GATGGAGAGCAGACCTGGAG GGG Intergenic
No off target data available for this crispr