ID: 959739845

View in Genome Browser
Species Human (GRCh38)
Location 3:109705368-109705390
Sequence GATAGAGTGCTTATGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959739845_959739852 30 Left 959739845 3:109705368-109705390 CCAGATCTCATAAGCACTCTATC No data
Right 959739852 3:109705421-109705443 TGATTCAGTCACCTCCCATGAGG No data
959739845_959739848 -6 Left 959739845 3:109705368-109705390 CCAGATCTCATAAGCACTCTATC No data
Right 959739848 3:109705385-109705407 TCTATCACAAGAGCAGCAAGGGG No data
959739845_959739847 -7 Left 959739845 3:109705368-109705390 CCAGATCTCATAAGCACTCTATC No data
Right 959739847 3:109705384-109705406 CTCTATCACAAGAGCAGCAAGGG No data
959739845_959739846 -8 Left 959739845 3:109705368-109705390 CCAGATCTCATAAGCACTCTATC No data
Right 959739846 3:109705383-109705405 ACTCTATCACAAGAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959739845 Original CRISPR GATAGAGTGCTTATGAGATC TGG (reversed) Intergenic
No off target data available for this crispr