ID: 959739847

View in Genome Browser
Species Human (GRCh38)
Location 3:109705384-109705406
Sequence CTCTATCACAAGAGCAGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959739845_959739847 -7 Left 959739845 3:109705368-109705390 CCAGATCTCATAAGCACTCTATC No data
Right 959739847 3:109705384-109705406 CTCTATCACAAGAGCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959739847 Original CRISPR CTCTATCACAAGAGCAGCAA GGG Intergenic
No off target data available for this crispr