ID: 959741994

View in Genome Browser
Species Human (GRCh38)
Location 3:109731133-109731155
Sequence CATGAGAGGGACACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959741994_959742008 21 Left 959741994 3:109731133-109731155 CCTCCCACTGTGTCCCTCTCATG No data
Right 959742008 3:109731177-109731199 CACAACCTGAGATTTGAATGGGG No data
959741994_959742007 20 Left 959741994 3:109731133-109731155 CCTCCCACTGTGTCCCTCTCATG No data
Right 959742007 3:109731176-109731198 CCACAACCTGAGATTTGAATGGG No data
959741994_959742003 -5 Left 959741994 3:109731133-109731155 CCTCCCACTGTGTCCCTCTCATG No data
Right 959742003 3:109731151-109731173 TCATGACAGGTGGGAACCATGGG No data
959741994_959742005 19 Left 959741994 3:109731133-109731155 CCTCCCACTGTGTCCCTCTCATG No data
Right 959742005 3:109731175-109731197 GCCACAACCTGAGATTTGAATGG No data
959741994_959742002 -6 Left 959741994 3:109731133-109731155 CCTCCCACTGTGTCCCTCTCATG No data
Right 959742002 3:109731150-109731172 CTCATGACAGGTGGGAACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959741994 Original CRISPR CATGAGAGGGACACAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr