ID: 959743699

View in Genome Browser
Species Human (GRCh38)
Location 3:109751551-109751573
Sequence TGAGTTCTGAAAATAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959743699_959743700 -10 Left 959743699 3:109751551-109751573 CCATTATCTATTTTCAGAACTCA No data
Right 959743700 3:109751564-109751586 TCAGAACTCAGTTGACTCTGTGG No data
959743699_959743704 -4 Left 959743699 3:109751551-109751573 CCATTATCTATTTTCAGAACTCA No data
Right 959743704 3:109751570-109751592 CTCAGTTGACTCTGTGGGGGTGG No data
959743699_959743703 -7 Left 959743699 3:109751551-109751573 CCATTATCTATTTTCAGAACTCA No data
Right 959743703 3:109751567-109751589 GAACTCAGTTGACTCTGTGGGGG No data
959743699_959743702 -8 Left 959743699 3:109751551-109751573 CCATTATCTATTTTCAGAACTCA No data
Right 959743702 3:109751566-109751588 AGAACTCAGTTGACTCTGTGGGG No data
959743699_959743701 -9 Left 959743699 3:109751551-109751573 CCATTATCTATTTTCAGAACTCA No data
Right 959743701 3:109751565-109751587 CAGAACTCAGTTGACTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959743699 Original CRISPR TGAGTTCTGAAAATAGATAA TGG (reversed) Intergenic
No off target data available for this crispr