ID: 959743702

View in Genome Browser
Species Human (GRCh38)
Location 3:109751566-109751588
Sequence AGAACTCAGTTGACTCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959743699_959743702 -8 Left 959743699 3:109751551-109751573 CCATTATCTATTTTCAGAACTCA No data
Right 959743702 3:109751566-109751588 AGAACTCAGTTGACTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959743702 Original CRISPR AGAACTCAGTTGACTCTGTG GGG Intergenic
No off target data available for this crispr