ID: 959744382

View in Genome Browser
Species Human (GRCh38)
Location 3:109759632-109759654
Sequence CCTTCTTTGCAGATGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959744382_959744387 25 Left 959744382 3:109759632-109759654 CCCAGCAGCATCTGCAAAGAAGG No data
Right 959744387 3:109759680-109759702 TTATTCCCTTATTTTGGTGAAGG No data
959744382_959744386 19 Left 959744382 3:109759632-109759654 CCCAGCAGCATCTGCAAAGAAGG No data
Right 959744386 3:109759674-109759696 CTTAGTTTATTCCCTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959744382 Original CRISPR CCTTCTTTGCAGATGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr