ID: 959746013

View in Genome Browser
Species Human (GRCh38)
Location 3:109777265-109777287
Sequence GACAGCTTTTGGACTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959746013_959746017 15 Left 959746013 3:109777265-109777287 CCAGTAACAGTCCAAAAGCTGTC No data
Right 959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
959746013_959746019 17 Left 959746013 3:109777265-109777287 CCAGTAACAGTCCAAAAGCTGTC No data
Right 959746019 3:109777305-109777327 TTATCTGCAGAAGATGGCAGGGG 0: 5
1: 1
2: 2
3: 22
4: 257
959746013_959746016 11 Left 959746013 3:109777265-109777287 CCAGTAACAGTCCAAAAGCTGTC No data
Right 959746016 3:109777299-109777321 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247
959746013_959746018 16 Left 959746013 3:109777265-109777287 CCAGTAACAGTCCAAAAGCTGTC No data
Right 959746018 3:109777304-109777326 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959746013 Original CRISPR GACAGCTTTTGGACTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr