ID: 959749356

View in Genome Browser
Species Human (GRCh38)
Location 3:109814778-109814800
Sequence CTGGCACCACAAAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959749356_959749361 21 Left 959749356 3:109814778-109814800 CCTTTCTCCCTTTGTGGTGCCAG No data
Right 959749361 3:109814822-109814844 CAAAAGAAACCATATATACAGGG No data
959749356_959749362 22 Left 959749356 3:109814778-109814800 CCTTTCTCCCTTTGTGGTGCCAG No data
Right 959749362 3:109814823-109814845 AAAAGAAACCATATATACAGGGG No data
959749356_959749360 20 Left 959749356 3:109814778-109814800 CCTTTCTCCCTTTGTGGTGCCAG No data
Right 959749360 3:109814821-109814843 TCAAAAGAAACCATATATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959749356 Original CRISPR CTGGCACCACAAAGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr