ID: 959750961

View in Genome Browser
Species Human (GRCh38)
Location 3:109834476-109834498
Sequence ATTTTATCTTGGCCAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959750961_959750964 9 Left 959750961 3:109834476-109834498 CCATGCACTGGCCAAGATAAAAT No data
Right 959750964 3:109834508-109834530 AATGTATATTTACAATGTGAGGG No data
959750961_959750963 8 Left 959750961 3:109834476-109834498 CCATGCACTGGCCAAGATAAAAT No data
Right 959750963 3:109834507-109834529 AAATGTATATTTACAATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959750961 Original CRISPR ATTTTATCTTGGCCAGTGCA TGG (reversed) Intergenic
No off target data available for this crispr