ID: 959755851

View in Genome Browser
Species Human (GRCh38)
Location 3:109898172-109898194
Sequence GTGGCTTCTCACTTCTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959755844_959755851 22 Left 959755844 3:109898127-109898149 CCTTATGTCTCTGCTGTATTGTT No data
Right 959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG No data
959755843_959755851 23 Left 959755843 3:109898126-109898148 CCCTTATGTCTCTGCTGTATTGT No data
Right 959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG No data
959755842_959755851 28 Left 959755842 3:109898121-109898143 CCGAACCCTTATGTCTCTGCTGT No data
Right 959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959755851 Original CRISPR GTGGCTTCTCACTTCTAGGA GGG Intergenic
No off target data available for this crispr