ID: 959759810

View in Genome Browser
Species Human (GRCh38)
Location 3:109947448-109947470
Sequence ATAGCTAGCCCTCTTTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959759810_959759815 11 Left 959759810 3:109947448-109947470 CCTTTTCAAAGAGGGCTAGCTAT No data
Right 959759815 3:109947482-109947504 GGATTCAAAATTATAGTGGTTGG No data
959759810_959759814 7 Left 959759810 3:109947448-109947470 CCTTTTCAAAGAGGGCTAGCTAT No data
Right 959759814 3:109947478-109947500 GACGGGATTCAAAATTATAGTGG No data
959759810_959759813 -10 Left 959759810 3:109947448-109947470 CCTTTTCAAAGAGGGCTAGCTAT No data
Right 959759813 3:109947461-109947483 GGCTAGCTATGTCTAAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959759810 Original CRISPR ATAGCTAGCCCTCTTTGAAA AGG (reversed) Intergenic