ID: 959759813

View in Genome Browser
Species Human (GRCh38)
Location 3:109947461-109947483
Sequence GGCTAGCTATGTCTAAGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959759810_959759813 -10 Left 959759810 3:109947448-109947470 CCTTTTCAAAGAGGGCTAGCTAT No data
Right 959759813 3:109947461-109947483 GGCTAGCTATGTCTAAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959759813 Original CRISPR GGCTAGCTATGTCTAAGGAC GGG Intergenic