ID: 959760351

View in Genome Browser
Species Human (GRCh38)
Location 3:109955760-109955782
Sequence CTATAAACAAATGTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959760351_959760355 20 Left 959760351 3:109955760-109955782 CCTTTCTCCACATTTGTTTATAG No data
Right 959760355 3:109955803-109955825 TAATGCTAACCTTGGTCACTTGG No data
959760351_959760354 12 Left 959760351 3:109955760-109955782 CCTTTCTCCACATTTGTTTATAG No data
Right 959760354 3:109955795-109955817 AACACTAATAATGCTAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959760351 Original CRISPR CTATAAACAAATGTGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr