ID: 959764944

View in Genome Browser
Species Human (GRCh38)
Location 3:110014385-110014407
Sequence TTATATAAGTACATGTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959764943_959764944 15 Left 959764943 3:110014347-110014369 CCAGGTTTCAATTCTATTTATGC No data
Right 959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG No data
959764942_959764944 16 Left 959764942 3:110014346-110014368 CCCAGGTTTCAATTCTATTTATG No data
Right 959764944 3:110014385-110014407 TTATATAAGTACATGTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959764944 Original CRISPR TTATATAAGTACATGTAACT TGG Intergenic
No off target data available for this crispr