ID: 959765245

View in Genome Browser
Species Human (GRCh38)
Location 3:110019000-110019022
Sequence TAGAAATGGGTCCGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765245_959765249 -10 Left 959765245 3:110019000-110019022 CCAGCCATCCGGACCCATTTCTA No data
Right 959765249 3:110019013-110019035 CCCATTTCTAGATACATCTGTGG No data
959765245_959765251 16 Left 959765245 3:110019000-110019022 CCAGCCATCCGGACCCATTTCTA No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765245 Original CRISPR TAGAAATGGGTCCGGATGGC TGG (reversed) Intergenic
No off target data available for this crispr