ID: 959765246

View in Genome Browser
Species Human (GRCh38)
Location 3:110019004-110019026
Sequence TATCTAGAAATGGGTCCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765246_959765251 12 Left 959765246 3:110019004-110019026 CCATCCGGACCCATTTCTAGATA No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765246 Original CRISPR TATCTAGAAATGGGTCCGGA TGG (reversed) Intergenic
No off target data available for this crispr