ID: 959765247

View in Genome Browser
Species Human (GRCh38)
Location 3:110019008-110019030
Sequence GATGTATCTAGAAATGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765247_959765251 8 Left 959765247 3:110019008-110019030 CCGGACCCATTTCTAGATACATC No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765247 Original CRISPR GATGTATCTAGAAATGGGTC CGG (reversed) Intergenic
No off target data available for this crispr