ID: 959765248

View in Genome Browser
Species Human (GRCh38)
Location 3:110019013-110019035
Sequence CCACAGATGTATCTAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765248_959765251 3 Left 959765248 3:110019013-110019035 CCCATTTCTAGATACATCTGTGG No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765248 Original CRISPR CCACAGATGTATCTAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr