ID: 959765251

View in Genome Browser
Species Human (GRCh38)
Location 3:110019039-110019061
Sequence TCAGCTTCTTTTATAGCATT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765248_959765251 3 Left 959765248 3:110019013-110019035 CCCATTTCTAGATACATCTGTGG No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data
959765246_959765251 12 Left 959765246 3:110019004-110019026 CCATCCGGACCCATTTCTAGATA No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data
959765250_959765251 2 Left 959765250 3:110019014-110019036 CCATTTCTAGATACATCTGTGGT No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data
959765245_959765251 16 Left 959765245 3:110019000-110019022 CCAGCCATCCGGACCCATTTCTA No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data
959765247_959765251 8 Left 959765247 3:110019008-110019030 CCGGACCCATTTCTAGATACATC No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data
959765244_959765251 22 Left 959765244 3:110018994-110019016 CCTCTTCCAGCCATCCGGACCCA No data
Right 959765251 3:110019039-110019061 TCAGCTTCTTTTATAGCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765251 Original CRISPR TCAGCTTCTTTTATAGCATT CGG Intergenic
No off target data available for this crispr