ID: 959765865

View in Genome Browser
Species Human (GRCh38)
Location 3:110027265-110027287
Sequence CAGTGTAATCTTGCAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765865_959765870 17 Left 959765865 3:110027265-110027287 CCTGCCACTGCAAGATTACACTG No data
Right 959765870 3:110027305-110027327 TAATCGAATTAGTGTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765865 Original CRISPR CAGTGTAATCTTGCAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr