ID: 959765870

View in Genome Browser
Species Human (GRCh38)
Location 3:110027305-110027327
Sequence TAATCGAATTAGTGTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959765865_959765870 17 Left 959765865 3:110027265-110027287 CCTGCCACTGCAAGATTACACTG No data
Right 959765870 3:110027305-110027327 TAATCGAATTAGTGTTTGAGAGG No data
959765868_959765870 13 Left 959765868 3:110027269-110027291 CCACTGCAAGATTACACTGGGTA No data
Right 959765870 3:110027305-110027327 TAATCGAATTAGTGTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959765870 Original CRISPR TAATCGAATTAGTGTTTGAG AGG Intergenic
No off target data available for this crispr