ID: 959770636

View in Genome Browser
Species Human (GRCh38)
Location 3:110090911-110090933
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959770635_959770636 -4 Left 959770635 3:110090892-110090914 CCATTACATGCAAATTGAGGGGC No data
Right 959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG No data
959770631_959770636 3 Left 959770631 3:110090885-110090907 CCACTTACCATTACATGCAAATT No data
Right 959770636 3:110090911-110090933 GGGCAAGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type