ID: 959773740

View in Genome Browser
Species Human (GRCh38)
Location 3:110132074-110132096
Sequence TGTCCTTTGCAGGACATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959773735_959773740 16 Left 959773735 3:110132035-110132057 CCATGGACTACTACGCAGCCATA 0: 5
1: 723
2: 27181
3: 15797
4: 8134
Right 959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG No data
959773738_959773740 -2 Left 959773738 3:110132053-110132075 CCATAAAAGGGAATGTCATCATG No data
Right 959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959773740 Original CRISPR TGTCCTTTGCAGGACATAGA TGG Intergenic
No off target data available for this crispr