ID: 959775107

View in Genome Browser
Species Human (GRCh38)
Location 3:110150195-110150217
Sequence GTGCCCACCCAGACTGAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3103
Summary {0: 3, 1: 122, 2: 578, 3: 1109, 4: 1291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959775107_959775109 7 Left 959775107 3:110150195-110150217 CCGCTCTCAGTCTGGGTGGGCAC 0: 3
1: 122
2: 578
3: 1109
4: 1291
Right 959775109 3:110150225-110150247 TCAGCTGCCAGCACAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959775107 Original CRISPR GTGCCCACCCAGACTGAGAG CGG (reversed) Intergenic
Too many off-targets to display for this crispr