ID: 959775107 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:110150195-110150217 |
| Sequence | GTGCCCACCCAGACTGAGAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3103 | |||
| Summary | {0: 3, 1: 122, 2: 578, 3: 1109, 4: 1291} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959775107_959775109 | 7 | Left | 959775107 | 3:110150195-110150217 | CCGCTCTCAGTCTGGGTGGGCAC | 0: 3 1: 122 2: 578 3: 1109 4: 1291 |
||
| Right | 959775109 | 3:110150225-110150247 | TCAGCTGCCAGCACAAAAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959775107 | Original CRISPR | GTGCCCACCCAGACTGAGAG CGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||