ID: 959780382

View in Genome Browser
Species Human (GRCh38)
Location 3:110225158-110225180
Sequence CTTCCTTTATTCTGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959780382_959780383 -2 Left 959780382 3:110225158-110225180 CCTTTTTTTCAGAATAAAGGAAG No data
Right 959780383 3:110225179-110225201 AGATAGAAATAAAATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959780382 Original CRISPR CTTCCTTTATTCTGAAAAAA AGG (reversed) Intergenic
No off target data available for this crispr