ID: 959783178

View in Genome Browser
Species Human (GRCh38)
Location 3:110260670-110260692
Sequence TAAAGCTGTACTTTTACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959783178_959783182 30 Left 959783178 3:110260670-110260692 CCAACTGTAAAAGTACAGCTTTA No data
Right 959783182 3:110260723-110260745 TTAAGATCTCTGGCCAAGTTTGG No data
959783178_959783180 -2 Left 959783178 3:110260670-110260692 CCAACTGTAAAAGTACAGCTTTA No data
Right 959783180 3:110260691-110260713 TAGCATGTTAAGGAAAATATAGG No data
959783178_959783181 20 Left 959783178 3:110260670-110260692 CCAACTGTAAAAGTACAGCTTTA No data
Right 959783181 3:110260713-110260735 GTGACTGTTTTTAAGATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959783178 Original CRISPR TAAAGCTGTACTTTTACAGT TGG (reversed) Intergenic
No off target data available for this crispr