ID: 959783182

View in Genome Browser
Species Human (GRCh38)
Location 3:110260723-110260745
Sequence TTAAGATCTCTGGCCAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959783178_959783182 30 Left 959783178 3:110260670-110260692 CCAACTGTAAAAGTACAGCTTTA No data
Right 959783182 3:110260723-110260745 TTAAGATCTCTGGCCAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959783182 Original CRISPR TTAAGATCTCTGGCCAAGTT TGG Intergenic
No off target data available for this crispr