ID: 959791635

View in Genome Browser
Species Human (GRCh38)
Location 3:110368657-110368679
Sequence TCTCATCTATGGTTTCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959791631_959791635 -5 Left 959791631 3:110368639-110368661 CCCCAATACTACTGAATGTCTCA No data
Right 959791635 3:110368657-110368679 TCTCATCTATGGTTTCCTGTAGG No data
959791632_959791635 -6 Left 959791632 3:110368640-110368662 CCCAATACTACTGAATGTCTCAT No data
Right 959791635 3:110368657-110368679 TCTCATCTATGGTTTCCTGTAGG No data
959791633_959791635 -7 Left 959791633 3:110368641-110368663 CCAATACTACTGAATGTCTCATC No data
Right 959791635 3:110368657-110368679 TCTCATCTATGGTTTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959791635 Original CRISPR TCTCATCTATGGTTTCCTGT AGG Intergenic
No off target data available for this crispr