ID: 959795456

View in Genome Browser
Species Human (GRCh38)
Location 3:110422560-110422582
Sequence GACAATGATGATAGTGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959795455_959795456 6 Left 959795455 3:110422531-110422553 CCTGAGAATAGTCAGTAAGAATT No data
Right 959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG No data
959795454_959795456 7 Left 959795454 3:110422530-110422552 CCCTGAGAATAGTCAGTAAGAAT No data
Right 959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959795456 Original CRISPR GACAATGATGATAGTGATAG TGG Intergenic
No off target data available for this crispr