ID: 959797375

View in Genome Browser
Species Human (GRCh38)
Location 3:110446325-110446347
Sequence ATGCAGTTATTGCTTAAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959797375_959797376 2 Left 959797375 3:110446325-110446347 CCGTGCTTAAGCAATAACTGCAT No data
Right 959797376 3:110446350-110446372 TGACTTTAATAATACTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959797375 Original CRISPR ATGCAGTTATTGCTTAAGCA CGG (reversed) Intergenic
No off target data available for this crispr