ID: 959798593

View in Genome Browser
Species Human (GRCh38)
Location 3:110462949-110462971
Sequence TGGCCACTCAATTTAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959798593_959798597 1 Left 959798593 3:110462949-110462971 CCTCCCACTAAATTGAGTGGCCA No data
Right 959798597 3:110462973-110462995 GCCTACCTATTAATTGCCACAGG No data
959798593_959798602 27 Left 959798593 3:110462949-110462971 CCTCCCACTAAATTGAGTGGCCA No data
Right 959798602 3:110462999-110463021 TTTTACAGGAGCTAAATCAGAGG No data
959798593_959798600 13 Left 959798593 3:110462949-110462971 CCTCCCACTAAATTGAGTGGCCA No data
Right 959798600 3:110462985-110463007 ATTGCCACAGGTAATTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959798593 Original CRISPR TGGCCACTCAATTTAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr