ID: 959800367

View in Genome Browser
Species Human (GRCh38)
Location 3:110487109-110487131
Sequence GAATTAGACCAGCTTGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959800364_959800367 19 Left 959800364 3:110487067-110487089 CCAAACAGAGACTCCTACATCTA No data
Right 959800367 3:110487109-110487131 GAATTAGACCAGCTTGACCCAGG No data
959800365_959800367 6 Left 959800365 3:110487080-110487102 CCTACATCTATGATTTCAGAGAA No data
Right 959800367 3:110487109-110487131 GAATTAGACCAGCTTGACCCAGG No data
959800363_959800367 23 Left 959800363 3:110487063-110487085 CCATCCAAACAGAGACTCCTACA No data
Right 959800367 3:110487109-110487131 GAATTAGACCAGCTTGACCCAGG No data
959800362_959800367 24 Left 959800362 3:110487062-110487084 CCCATCCAAACAGAGACTCCTAC No data
Right 959800367 3:110487109-110487131 GAATTAGACCAGCTTGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959800367 Original CRISPR GAATTAGACCAGCTTGACCC AGG Intergenic
No off target data available for this crispr