ID: 959802622

View in Genome Browser
Species Human (GRCh38)
Location 3:110512966-110512988
Sequence CTGTGAAAGTGGGAAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959802622_959802630 0 Left 959802622 3:110512966-110512988 CCCTCCTTTTCCCACTTTCACAG No data
Right 959802630 3:110512989-110513011 TTTGGGCACTCACAGTATTTGGG 0: 74
1: 199
2: 193
3: 131
4: 245
959802622_959802631 1 Left 959802622 3:110512966-110512988 CCCTCCTTTTCCCACTTTCACAG No data
Right 959802631 3:110512990-110513012 TTGGGCACTCACAGTATTTGGGG 0: 64
1: 165
2: 141
3: 76
4: 170
959802622_959802629 -1 Left 959802622 3:110512966-110512988 CCCTCCTTTTCCCACTTTCACAG No data
Right 959802629 3:110512988-110513010 GTTTGGGCACTCACAGTATTTGG 0: 73
1: 168
2: 184
3: 94
4: 152
959802622_959802632 12 Left 959802622 3:110512966-110512988 CCCTCCTTTTCCCACTTTCACAG No data
Right 959802632 3:110513001-110513023 CAGTATTTGGGGTGTCTCCCAGG 0: 73
1: 193
2: 208
3: 149
4: 174
959802622_959802633 21 Left 959802622 3:110512966-110512988 CCCTCCTTTTCCCACTTTCACAG No data
Right 959802633 3:110513010-110513032 GGGTGTCTCCCAGGTCCTGCAGG 0: 45
1: 113
2: 221
3: 224
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959802622 Original CRISPR CTGTGAAAGTGGGAAAAGGA GGG (reversed) Intergenic
No off target data available for this crispr