ID: 959803246

View in Genome Browser
Species Human (GRCh38)
Location 3:110521054-110521076
Sequence CCAAACTCTGAAGCAAAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959803246_959803250 9 Left 959803246 3:110521054-110521076 CCTAACTTTGCTTCAGAGTTTGG No data
Right 959803250 3:110521086-110521108 TCTATTGGATTGCAGTTTCTGGG No data
959803246_959803249 8 Left 959803246 3:110521054-110521076 CCTAACTTTGCTTCAGAGTTTGG No data
Right 959803249 3:110521085-110521107 TTCTATTGGATTGCAGTTTCTGG No data
959803246_959803248 -6 Left 959803246 3:110521054-110521076 CCTAACTTTGCTTCAGAGTTTGG No data
Right 959803248 3:110521071-110521093 GTTTGGTATTTTGTTTCTATTGG No data
959803246_959803251 14 Left 959803246 3:110521054-110521076 CCTAACTTTGCTTCAGAGTTTGG No data
Right 959803251 3:110521091-110521113 TGGATTGCAGTTTCTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959803246 Original CRISPR CCAAACTCTGAAGCAAAGTT AGG (reversed) Intergenic
No off target data available for this crispr