ID: 959803249

View in Genome Browser
Species Human (GRCh38)
Location 3:110521085-110521107
Sequence TTCTATTGGATTGCAGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959803246_959803249 8 Left 959803246 3:110521054-110521076 CCTAACTTTGCTTCAGAGTTTGG No data
Right 959803249 3:110521085-110521107 TTCTATTGGATTGCAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959803249 Original CRISPR TTCTATTGGATTGCAGTTTC TGG Intergenic
No off target data available for this crispr