ID: 959810314

View in Genome Browser
Species Human (GRCh38)
Location 3:110611388-110611410
Sequence GATACTACCTACACTTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959810313_959810314 2 Left 959810313 3:110611363-110611385 CCTGTCACTTCAGCATGGGTTCA No data
Right 959810314 3:110611388-110611410 GATACTACCTACACTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959810314 Original CRISPR GATACTACCTACACTTGCTG AGG Intergenic
No off target data available for this crispr