ID: 959825655

View in Genome Browser
Species Human (GRCh38)
Location 3:110792909-110792931
Sequence TGCTGCACAAAACTTCTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959825655_959825656 -2 Left 959825655 3:110792909-110792931 CCTATGAGAAGTTTTGTGCAGCA No data
Right 959825656 3:110792930-110792952 CACCGAGAAACAAATAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959825655 Original CRISPR TGCTGCACAAAACTTCTCAT AGG (reversed) Intergenic
No off target data available for this crispr