ID: 959833556

View in Genome Browser
Species Human (GRCh38)
Location 3:110892555-110892577
Sequence GGGTTCCGGTGTGATGCATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959833556 Original CRISPR GGGTTCCGGTGTGATGCATC AGG (reversed) Exonic
901478036 1:9504426-9504448 GGGTTCCAGGGTGAGGCATGAGG + Intergenic
910899842 1:92108134-92108156 GGGTTCCACTGTGATTCCTCAGG + Intronic
918912468 1:190591585-190591607 GGGTTCCGGGGGAATGCATCAGG + Intergenic
921095712 1:211885538-211885560 GGGTACCAGGGTGATGCAGCAGG - Intergenic
922982061 1:229835510-229835532 GGGTTTCGGGGAGATGCATTTGG + Intergenic
1070307425 10:75247978-75248000 GGGTGCCAGTGTGACGGATCTGG - Intergenic
1070523124 10:77271804-77271826 GGGTTGTGGTGTTTTGCATCAGG - Intronic
1071927522 10:90427757-90427779 GGATTCTGATGTGATGCCTCAGG + Intergenic
1086263220 11:84966372-84966394 GGGTTCTGTTGTGGTGCCTCAGG - Intronic
1092572211 12:9738436-9738458 GGATTCAGGTGTGAGCCATCGGG + Intergenic
1093751670 12:22807275-22807297 GGGTTACAGTGTGATGTTTCTGG - Intergenic
1094524980 12:31225519-31225541 GGGTTCTGGTGTCATGGACCTGG + Intergenic
1095485077 12:42676395-42676417 GGGTTCAGGTGTGCTGACTCAGG - Intergenic
1096775461 12:53961035-53961057 AGGTTCCGGTGTAATTCAGCGGG + Intergenic
1117348957 14:54861991-54862013 GGCTTCTGATGTGATGTATCTGG + Intronic
1122416041 14:101549905-101549927 GAGTTTCAGTGTGATGCATTTGG - Intergenic
1124438964 15:29673621-29673643 GGGTTTAGGAGTCATGCATCTGG - Intergenic
1140406008 16:74712061-74712083 GGGTTCCGGTGACAGGCTTCAGG + Intergenic
1148234777 17:45961439-45961461 GGGTGCCGGTGTGGTGAATGGGG + Intronic
1151102673 17:71573811-71573833 GGCTTCAGGTGTAATGCATAGGG + Intergenic
1156244132 18:35281825-35281847 GGGAACCTGTGGGATGCATCTGG - Intronic
1163476366 19:17528444-17528466 GGGTTCAGGTGGGAGGCATAGGG + Intronic
925772891 2:7300718-7300740 GGGAGCCGGTGAGATGTATCCGG - Intergenic
940015065 2:149095690-149095712 GGGTGCAGGTGTGATGCAAGGGG + Intronic
946309070 2:218872833-218872855 GGGTTCGGGCCTGAGGCATCGGG + Intronic
1181524239 22:23470109-23470131 GGGATCCTGTGTGAAGCACCCGG - Intergenic
1184741935 22:46433544-46433566 GGATTGCGCTGTGAGGCATCAGG + Intronic
953251144 3:41246710-41246732 TGGTTCCTGTGGAATGCATCTGG - Exonic
955523482 3:59797600-59797622 GGGTTACTGTGTGATGAAACAGG - Intronic
956886611 3:73566532-73566554 GGGTTCCAGTAGGATGAATCTGG + Intronic
959833556 3:110892555-110892577 GGGTTCCGGTGTGATGCATCAGG - Exonic
962652364 3:137509518-137509540 GGGTCCCGGCGTGAGGCACCTGG - Intergenic
967938823 3:194750384-194750406 TGGTTTGGGAGTGATGCATCTGG + Intergenic
985536202 5:467018-467040 AGGTGCCAGTGTGATGCACCGGG + Exonic
986503410 5:8425633-8425655 GGGATCCGGTTTGGGGCATCAGG + Intergenic
994053103 5:95384175-95384197 GGAATTCGGTGTGATGCATCCGG + Intergenic
999175476 5:149628905-149628927 GGGCTCCGGTGTTAGACATCGGG - Exonic
1015390716 6:132678447-132678469 GGGGTCTGGTGGGAGGCATCTGG - Intergenic
1016031140 6:139339530-139339552 GGCTTCAGCTGTGAAGCATCTGG + Intergenic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1033807839 7:144975064-144975086 GTGGTCCAGTGTGATGCAACAGG - Intergenic
1034442160 7:151091240-151091262 GGGTGCCGGGGACATGCATCTGG + Intronic
1044145765 8:88711898-88711920 GGGGTCAGGGGTGATGCTTCTGG - Intergenic
1057129135 9:92641092-92641114 GGGTTGGGCTGTGATGCAGCTGG - Intronic
1059867906 9:118537074-118537096 GGGTTTTTGTGTAATGCATCTGG + Intergenic
1061302930 9:129716369-129716391 GGGCTCCGGTGTGCTGAATGGGG + Intronic
1062104394 9:134745553-134745575 GGGGTGCGGTCTGAGGCATCAGG + Intronic
1195870519 X:109480757-109480779 TGGTACCGATGTGATGCATTTGG + Intronic
1196470402 X:116017753-116017775 GGGTTCAGGTGTGCTGTATTAGG + Intergenic