ID: 959833662

View in Genome Browser
Species Human (GRCh38)
Location 3:110893272-110893294
Sequence AAGGACAAAAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3996
Summary {0: 1, 1: 1, 2: 21, 3: 437, 4: 3536}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959833662_959833670 16 Left 959833662 3:110893272-110893294 CCTTCCTCCTTCTTTTTGTCCTT 0: 1
1: 1
2: 21
3: 437
4: 3536
Right 959833670 3:110893311-110893333 GCCTATACTTTTTGAGGAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 153
959833662_959833668 10 Left 959833662 3:110893272-110893294 CCTTCCTCCTTCTTTTTGTCCTT 0: 1
1: 1
2: 21
3: 437
4: 3536
Right 959833668 3:110893305-110893327 TATGATGCCTATACTTTTTGAGG 0: 1
1: 0
2: 2
3: 22
4: 214
959833662_959833669 15 Left 959833662 3:110893272-110893294 CCTTCCTCCTTCTTTTTGTCCTT 0: 1
1: 1
2: 21
3: 437
4: 3536
Right 959833669 3:110893310-110893332 TGCCTATACTTTTTGAGGAGTGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959833662 Original CRISPR AAGGACAAAAAGAAGGAGGA AGG (reversed) Exonic
Too many off-targets to display for this crispr