ID: 959837214

View in Genome Browser
Species Human (GRCh38)
Location 3:110933568-110933590
Sequence AAAGCCTCCTGGATTGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959837214_959837218 2 Left 959837214 3:110933568-110933590 CCAAATTCAATCCAGGAGGCTTT No data
Right 959837218 3:110933593-110933615 AAGGTAGCCAAAACTGAGGATGG No data
959837214_959837217 -2 Left 959837214 3:110933568-110933590 CCAAATTCAATCCAGGAGGCTTT No data
Right 959837217 3:110933589-110933611 TTCTAAGGTAGCCAAAACTGAGG No data
959837214_959837220 27 Left 959837214 3:110933568-110933590 CCAAATTCAATCCAGGAGGCTTT No data
Right 959837220 3:110933618-110933640 TTTTACCTCATTTGAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959837214 Original CRISPR AAAGCCTCCTGGATTGAATT TGG (reversed) Intergenic
No off target data available for this crispr