ID: 959840344

View in Genome Browser
Species Human (GRCh38)
Location 3:110967781-110967803
Sequence TACACCGAAGTGCCTCCAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959840344_959840346 1 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840346 3:110967805-110967827 TCAACTTGAACACTTTGGAATGG No data
959840344_959840345 -4 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840345 3:110967800-110967822 TGTAATCAACTTGAACACTTTGG No data
959840344_959840347 29 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840347 3:110967833-110967855 GCTCCAGATCTCATCCTCCAAGG No data
959840344_959840348 30 Left 959840344 3:110967781-110967803 CCGATTGGAGGCACTTCGGTGTA No data
Right 959840348 3:110967834-110967856 CTCCAGATCTCATCCTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959840344 Original CRISPR TACACCGAAGTGCCTCCAAT CGG (reversed) Intergenic
No off target data available for this crispr